header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-6172
Transcript Name: zbtb26-201
Previous Name: si:ch211-236k19.4-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000022948 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000022948|OTTDARG00000018822|ZDB-GENE-060526-122 si:ch211-236k19.4|OTTDARP00000019139 CH211-236K19.4-001 LG_ BX255921.2 Danio rerio protein_coding NOVEL, 1299 bp
TACAGGAGCTGCAGGACCAGAAAACACCCAGATAGAGACA
AAACTGTCGCAGTAGCCCACACCATGGCTCAGGACGGGGT
GATACTGCAGTTCAACTTTGCCACATTCGGGGACTCCATG
CTCCAAAAGATGGATGCTCTTCGTCGAGACAGGCGTTTTT
GTGATGTGGTGGTCCGCATCAATGACTTGGAGGTGCCTGG
ACACAAAGTGGTGTTCGCTGCCGGCTCCCCTTTCCTCAGA
GACCAGTTTGTCCTTCAGGACTCGAATGAAGTCCAAATAG
CTACACAGCAGGATGCTGAGGTAGGTCAGAAGCTTCTTCT
GTCCTGCTACACCGGGACGCTTCAGTTCCCAGAACTTGAA
TTAGTACACTATTTAACCGTAGCCAGCTTTCTGCAGATGG
GTCATATTGTGGAGCAGTGCACCGAAGCGCTAAATAAATT
CATAAAACCACATGAGGTCAAAGATGAGCGTGCATCATCG
CGACAGCCTTCAGACTTTACCCCTCAGCGCAATCAAGCGG
CTGTGAAGAAAGTGTGTGATGAAGAGGATGAGGTGGACAA
TGAAGAAGATGAGTTTGATGATGATGATGACGATGATGAT
GTGATCATACAGCCCAAATCTCCACCAGCGGTGTTTAGAA
ACAACAACAGTAGAGAAGACAGTCCGATTAGCATCGTTAA
AGTGGAGTCATTAGATGAGCGCGTGCCTGACAACTTCCAG
AGTCGCTCCAGTCGCAGTCGCTCCCCAACACTACGCTCAC
CTGAGCCACAACACTCCCTGATAAACTCCACCGTGGAAAC
CCGGCCTGCTGAAATCACCGTTAATCCCACAGCTGAATAT
TCAATGTCTACACCCGGACCTAGCGGATCTGGGAAGGGGA
ATCTATGGGGGGGATGCTCCAGGAACGGGGAGAAGAGCAT
GCAGTGGTACCACCAGTGCCCAAAATGCGCACGTGTATTT
CGTCAGCTGGAGAACTACGCCAACCATCTGAAGATGCACA
AGCTGTTTATGTGCCTCCTGTGTGGAAAGACGTTTACCCA
GAAAGGAAACCTGCACCGGCACATGCGGGTCCACGCCGGC
ATCAAACCCTTCCAGTGTAAGATCTGCGGGAAGACGTTTA
CTCAGAAGTGCTCGCTGCTGGACCACCTGAACCTTCACAG
CGGGGACAAACCACACCGCTGTAACTACTGCGACATGGTG
TTTGCGCACAAACCAGTTCTCCGTAAACACCTGAAGCAGA
TCCATGGGAAAAACAGCTTTGATAATGCCAACGAAGGCAG
TTTGCTGGAAGGATTATAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
zbtb26-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000022948 (1),  Ensembl_Trans:ENSDART00000145831 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:CD750700 (1) 761 bp
CITATIONS (2)