Transcript

hpcal1-202

ID
ZDB-TSCRIPT-090929-613
Name
hpcal1-202
Previous Names
  • hpcal1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000006040 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000006040|OTTDARG00000005574|ZDB-GENE-040426-1242 hpcal1|OTTDARP00000005400 DKEY-181F18.1-001 LG_none BX000361.8,BX511210.5,BX511244.8 Danio rerio protein_coding KNOWN, 1791 bp
GAGGTTTCAAGTGCGCCTTTGAGATGTTATGGAGTCCGTG
GAATATTATTTCTTCAATTTATAACTTTTCCACTCCTTTT
TATTAAAACAGCATTCCAACTTTAAGACTACAAAATCGAG
CTGTACGTCTACGCATAGCGTATTAGCACTTTTGTTTGTT
TATAGAAGCTTCTGTTAGTTTTTTCACACAGCGAAAATGC
TGAAAGTTTTGTGAGGACACTCCTTCAAGACACGACGAAG
CAAGGCTACAGTCGACAAATTGAAGTGTAAAGCAGCTCTC
TATTTTTCTTTAGGGAAGCATCAAGGAACTGGGAAGTGTC
CAATAGAGCCTTTCATCATGGGTAAACAGAACAGTAAGTT
GCGACCCGAGGTGCTGAATGACCTGCGGGAGAACACAGAG
TTCACAGACCACGAGCTGCAGGAGTGGTACCGCGGTTTTC
TGAAGGACTGTCCGTCCGGCCATCTGACGGTGGAGGAGTT
CAAGAAGATCTATGCCAATTTCTTCCCCTACGGTGATGCT
TCCAAGTTTGCAGAGCACGTCTTTCGCACCTTCGACACCA
ACAGTGATGCCACCATTGACTTTCGGGAGTTCATCATCGC
CCTAAGCGTGACATCCCGTGGAGGCCTGGAGCAGAAACTG
CGCTGGGCCTTCAGCATGTACGATCTGGACGGCAACGGAT
ACATCAGCCGAGCCGAAATGCTGGAGATTGTACAGGCGAT
TTATAAAATGGTGTCATCTGTGATGAAGATGCCGGAGGAT
GAGTCAACGCCTGAGAAACGCACAGATAAGATATTCCGAC
AGATGGACACAGACAACGATGGTAGACTGTCTCTGGAGGA
ATTCATCAAAGGTGCCAAGAGTGACCCGTCTATTGTCAGG
CTCCTGCAGTCTGACCAGAGCAGCTCTCGACAGTTATAAA
CGCCGCTGAAAGAACACCTAACATGCACACTAAAAAAACA
AAATCATTATAGAAAGGTTGTTACTGCCGTTATCAATGAT
ACTTTTCAAGAACTTTTCTGCTTCAACAGTTTCCTTTGAT
GATTGGTGATGAGCTGGTCGATGGGTTTATTTTGACGTAG
TGCTGTTTGGATTGATATTGTTGCGTTCTCTGAATCTGGG
CTGGGGTGGTCGTTTTATTCCATTTGAAGAAATAGACTAT
TATCAGACATTCATGTTATAAAAAGTACTCTTCTGGTTGC
ATCCATTCAGAAGGAAGCTGTGGAAACTGTTTGCTGTCTT
GAAGTGCTGAATGAAAATATGTATGTTTTAAATTGTTTGC
ATTCCACTCAAAATGGTAAATGACTTGGTGAGTACCCCGA
GCACATTCCCTGAATGACCATTAGGCCAGAACATGAAGTT
CTGCTTGTAAATGTTTCTTGCTTCGCATTCATTCCGAAAA
TAAGTGGGATATAATACGAGAGCACTATTTACAGTACATT
CCCTTGACAGTTTGTAAATATGTTGATCAGTATTTGCATG
AGATGTTTATTGATGCATCAGGTGGTTTAGCTGCGTTCAG
AGCCATCTGCTGTCCTGCCAATGATGATCGACTAGGAAAA
TCTGTGTACTTTATTTTCAAACGTGTGTTTTTACAGATGT
GAGAGAACATGCCAACAGTTTGCGGTCAGTCAATTGGATT
TATTTTATTTGTTTTTTTTAAAGATGCATACTTTTTATCT
CGATTTCTAATGAATCCTGTTCTTTTTAGTTTTGTATTTA
ATGAGGAATATAGAGGTAAACATTGGTTCCACAAAAATAT
TAAAGCTGCAGTAGGCAATTGTCTTCAGAGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations