header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-6101
Transcript Name: kctd10-002
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000022867 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000022867|OTTDARG00000016041|ZDB-GENE-040426-2843 kctd10|no_translation kctd10-002 LG_ BX510366.5 Danio rerio protein_coding KNOWN, 787 bp
ACCGGAAGTGATCTAATCCAGTCCCGTTTCAGGAGGCCCG
AAAGAATCGGGGAATTTCTATGGAAGAGATGTCAGGAGAA
AGTGTTGTGAGCTCGGCTGTGCCGGCAGCTACAACACGGA
CCACCTCTTTTAAGGGGTCCAGTCCCAGTTCCAAATATGT
GAAGCTGAATGTCGGTGGAGCGCTGTATTACACCACCATG
CAGACCCTGACCAAGCAGGACACCATGCTAAAGGCCATGT
TCAGTGGCCGTATGGAGGTCCTCACTGATAGCGAAGGCTG
GATTCTGATTGACAGGTGTGGGAAGCACTTTGGGACCATC
CTGAATTACCTGAGAGATGGAGTCGTCCCCTTACCTGAGA
GCCGGAGGGAAACTGAGGAGTTGCTGGCAGAGGCAAAGTA
TTACCTAGTGCAGGGCCTGGTAGATGAGTGTCAAGCAGCA
TTGCAGGTAAAGTACACACAACAAAAATGAAAATTGACTT
TAAATTTGCTAACCCACAACTCATTTAAACTTTCCAAAGT
TGTTTGTTTATCTCATGGTTTCCGCTACATTCATTCTTCC
GTGGCAGTGCGCCATGCCAAAATTCATCCCGCCACGGCTA
CATTATAGCTTCTCATTCAAGACATTTTATTTTTTTAATA
ACGGGTAATAATCGCACCAAAATGTATTAAAGTAGAAGTG
AATTATAATAGCGCAAACTTTTCTGTGACAGTAGTAGTGC
TTTGCGTCATTTATTTACCCTTTAAGGTGACGTGCTGACT
GACTGACTGACTGACAAGTGCGTGATG

kctd10 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA kctd10-002 787
mRNA kctd10-201 (1) 3853
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
kctd10-002 Contained in:

OTHER kctd10-002 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000022867 (1)
  • Ensembl_Trans:ENSDART00000141268 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:DV598600 (1) 793 bp
    CITATIONS (2)