header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-4353
Transcript Name: kctd10-201
Previous Name: kctd10-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000019238 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000019238|OTTDARG00000016041|ZDB-GENE-040426-2843 kctd10|OTTDARP00000016261 kctd10-001 LG_ BX510366.5 Danio rerio protein_coding KNOWN, 3853 bp
AGTCCCGTTTCAGGAGGCCCGAAAGAATCGGGGAATTTCT
ATGGAAGAGATGTCAGGAGAAAGTGTTGTGAGCTCGGCTG
TGCCGGCAGCTACAACACGGACCACCTCTTTTAAGGGGTC
CAGTCCCAGTTCCAAATATGTGAAGCTGAATGTCGGTGGA
GCGCTGTATTACACCACCATGCAGACCCTGACCAAGCAGG
ACACCATGCTAAAGGCCATGTTCAGTGGCCGTATGGAGGT
CCTCACTGATAGCGAAGGCTGGATTCTGATTGACAGGTGT
GGGAAGCACTTTGGGACCATCCTGAATTACCTGAGAGATG
GAGTCGTCCCCTTACCTGAGAGCCGGAGGGAAACTGAGGA
GTTGCTGGCAGAGGCAAAGTATTACCTAGTGCAGGGCCTG
GTAGATGAGTGTCAAGCAGCATTGCAGAACAAAGATGCAT
ATGAGCCATTCTGTAAAGTTCCCCTGGTGACATCATCTAA
GGAAGAACAGAGGCTCATTGCCACTGCTAATAAGCCTACA
GTCAAGCTGCTGTATAACAGAAGCAACAATAAATATTCAT
ATACAAGCAATTCTGATGACAACATGCTGAAGAATATCGA
GCTGTTTGACAAGCTGTCACTGAGGTTCAACGGCCGTGTG
CTTTTCATCAAGGATGTGATTGGTGATGAGATTTGTTGCT
GGTCGTTCTATGGCCAGGGCAGGAAAATTGCAGAGGTTTG
CTGCACGTCAATAGTCTATGCTACTGAAAAGAAGCAGACA
AAGGTTGAATTCCCAGAGGCTCGCATTTATGAAGAGACCC
TCAACATCTTGCTGTACGAGTCTCAAGACGGACGCGGACC
AGACAATGCACTGCTGGAGGCCACAGGGGGCGCTGCCGGT
CGATCCCACCACATCGATGAAGATGAAGAGAGAGAGCGCC
ATGACCGAGTGCGGAGGATCCATATCAAGCGGCCCGATGA
CCGTACCCACCACCATCAGTGACCCTGCCATTTCTCAGCT
TTTTCAGTGCCTTTTCAACTACCAGCGCTTCAGTTACGCC
TCTCGATTTGCACATGGACTCAGTCAGTTATGTTTATACC
TAGTCTGCTTCCTTAGAGAGATGAAGGGATATTCACAGAA
TAGCTAGTAGTATTAATAACGCTGCATGAACATGGCATAC
GGGGCAATCAAGTCACTCATCAGTTGTGCATTTTTGAGGA
CCTCTTTAAAAAGATACGACATGGTGTTAATGTGAACAAA
AGTGCATAGCGGATGGTTAGGTTTACTGCATGACATTCCC
TGAGCATTTTGCCCTATTTGCCATTCATAAAGCAAATTCC
AAAGTCAAGTCCATCAGCTGAACGTGCAGCTATTGAATAT
TAGAATAGAGTTCTCAGCCCTTGTATGTTTATTTAGCAAT
AATTGAACTTTTGTTCTGTCTGAGTGAAGTCAGTAGGGTT
TCTGGTGCCTTATAGGTGAACACTGTGCTTATTGAGTGTT
TTTGTTTTGCATATTGCGTGATGGTAATTTGATTTGAGAC
TTCTTTTTCTAAGTTTATCCCCAGTTTATTGTTAGCTTTG
TCTTTTGAATTGAAGGGTTGAAGCCAGTGTTACAGAGCTG
GTAGTGTCTTGCTGAGTTTTGTTTTGATTTTAAGCTGTTT
TGAAAAAGTGGTTCGACAGACCACTGATCATTGAATTCAA
TGAAGGAGGATGTTGTTGCCTTATAAGAATAATTTAAGTG
TCGTTTTTTTTTTTTTTTTTTTGGACGTTCAACCAAATGT
AATTTTTTCTGTTAGTTTACTCACCATTAGTCCATCTAAA
TTGTAGGGGCCTTTTTAAATCAACATTTTTGAGATTCATA
TTACTTTTGAGTCACCAATGACCAGTTTTAGCAACAACTC
TAATAGGCTAATAGTCGAAAAAGAGGCAAAACAAAAATGC
ATTCAACCAAAAGTTAACATTTTCTGTAATTAACTCCCCA
TTAGGCTGCCTAAATTGTATGGGACTTTTTTAATTTAACA
TTTTTGAGATTCATATTACCTTTAAGTCACCAAGGACCAG
TTTTTGCAACAAATCTAATATAGACTATTAGATTTGTTGC
TAAAACTAGTCCTTGGTGACTCAAAAGTAATATGAATCTT
AAAAAGTTGAATTGTTGTCCCCTACAATAATAGTCGAGGC
TAATATTCAAAAAAGAGGCAAAGCGAAAATGCATTCAACT
GAAATTTGACATTTTCTATAATTTACTCCCCATTAGGCCG
CCTAAATTGTCGGGGACTTTTTTAATTTAACATTTTTGAG
ATTCATATTATTTTTGAGTCACCAAGGACCAATTTTAGCA
ACAAATCTAATAGGCTAATAGTCGAAAAAGAGGCAAAACA
AAAATAAAGGTAGTTCTCAGAGATAGTTCACCCAAAACAA
ACTCATCCACATTTCATATCATTTACTCAACATTCAGTTT
GCACAAATGTGTTTGTTTCTCTTTTCTTTTCTGTGGAACA
CAAAATAAGTTACTTTAAAAATGCTGGAGACCTGTGACCA
TTGACTTCTATAGTATTTGATTTTCCTACTATGCAAGTCA
ATAGTTAAGTTTGTAGTATTGTTTTTATACATATATTTGT
TTTTTGTGTTTAACAGAATAAGGAAACTTGTAGGTTTGAA
ACAATTTGACTGAGTAAATAATTATTTTTGGATGAACACT
TTTTTTTGTATTTAAATAGTTGTAGCTCCATTGAGGCTCT
GTGACAGCGGTTCTCAATTTCAGTCCTGTTAGCGCCAACC
CCAATCAAACACACCTGCGCTAACTAATCAAGCTCTTACT
AGGCCATAGTTCCTCAAACTCAGTTCCTGGGGGGCCGCAG
GTCTGCACAGTTTTGCTTCAACTCTATCAAACACAGCTGA
TCCATATAATCAAGGTGTTCAAAAGATGAACACCATTATT
CGTTGGATCAGCTGTGTTTGATCAAGGTTTCAGCTAATTC
TGCAGAGCTGCGGCCCCCCAGGAATAAGTTTGAGACCTAT
GGGCTTTCTAGAAACATCCTTGCAGCTGTGTTGAGGCAAG
TTGGAGCTAAAATCTCCAGCACTGAGTTTGAGAACCCCTG
CTCTCTGATGTGAAACAATTGGTCTGTGCAAGAAAATAAT
TTCAAGACTCAAGTCTCAGCAGTTGTAGACCACTATGGTT
TCAGCTAAAAATGCTGTACTAAAAAAAATGAGGGGAGGGG
GCCTACATCTTCGTGAGTCTAAGATGAGTAAAATGACAGC
AAACTCCCATTTGTGTGAACTGTCACTTTTATTTTTTTCA
AATTGCTAGATTGATTGGATGAGTTTGGCCTCTAGGTGGC
AGTATAGTGTTATGCTGTTTTCTCACGTACATGAGGAAGC
ACTTGTAGATCAAAACCAGTAATAAAGTTTTCTATTCCCT
TTTTGGTCTACAACCAGAGTAAACTCTGATGACGCTTTTT
AAATACCTTTCCGCTGCACTGTATTAAATTCCATCAAGTT
AATTACGTGTTTTGTAAGCGATCTCATACAAGAGCAGAAA
CTGAGATGTAGTCAGAAGCATTCGGATGTATATCTGTAAC
TGAGTAATGGACACCAAGTATGAGTGCGTAATCAGAGACT
CTTCCACGTCAAAGCAGCTCCAGACGTTCAGGAACATAAA
GAAAGCCTCCTGCTGCAGCGTCTGTAGCATCACAGATCTT
TGCGCTCGTTAGTTTTATTAAAGGTGTATTCAACATAAAA
CAACAACTCTGAAATCTGTAATACTGTAGAGAAGTTTGTA
CAGTTGTGCACATAAATTTAAAAAATGTTTTACGTACAAA
GTATTTATACACAATGTTGTTATCACGAATAAAGGTTTCT
ACAAATTTCGTAG

kctd10 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA kctd10-002 (1) 787
mRNA kctd10-201 3853
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
kctd10-201 Contained in:

OTHER kctd10-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000019238 (1)
  • Ensembl_Trans:ENSDART00000136259 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC061457 (1) 3716 bp
    GenBank:CK142123 (1) 796 bp
    GenBank:CK025782 (1) 787 bp
    GenBank:AL925284 (1) 538 bp
    GenBank:BM534232 (1) 430 bp
    GenBank:BM530067 (1) 392 bp
    GenBank:CD602698 (1) 323 bp
    GenBank:CD588742 (1) 318 bp
    CITATIONS (2)