ZFIN ID: ZDB-TSCRIPT-090929-6044
Transcript Name: lrwd1-201
Previous Name: lrwd1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000022783 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000022783|OTTDARG00000018723|ZDB-GENE-030131-5335 lrwd1|OTTDARP00000019041 DKEY-261J4.9-001 LG_ AL935280.12 Danio rerio protein_coding KNOWN, 2660 bp
ATTTTCACCGAATGCAGCCATGGAGAAGATTACCGAGAAG
ATACTGCTGGAGAAAAGCTCTACAAAGACGAACAAACTGG
ACCAGATCAAGACCCTCAATCTGTCCCGCATGAGTCTGAA
GAGCGAGGATCTGCCTGTGCCTCTGCTGTCTAAACTGTGT
CGTCTGGAGAAGTTGGATTTGTCTGGGAATATGTTGCAGA
AGATCCCCAAAGGCCTCCGTCTGCCCTGCCTGAAGATCCT
GAACTGCTCAAACAATGATATGGAGGATGTGTTGTCGCTG
GAAGCCCTGACAAACTTAGAGGAACTTAGACTAGAGGACA
ACCTTTACCTCACAGTCAATGATGAACACAAAGTGATCTT
CCTGTTACCTAATCTGAGGATGTTCAATGGGAAGGATATC
AGTTCAACAGCTCATCATATTCGCCATGGGAGCACTGAGA
TCCTCAGGAAGCGGGTGATTGGTGTGTGGGAACGAGACTT
TAGTCTTCCTGATCCCATTTCAGCAAAAAGCCTTGCTGCT
GTTGAGAAGAGCTTTGTTAACGCTGCCTGCACACAAGTCA
AGTATGGCCCCAATTCCTTGAGTGATTACACAAAGTGGAG
GGTTGAAAAGATTGCAAAGGAGTATTTGAAGTCACTGACC
AGTAGTGAGGAGGAAGAACGGGTTGCAGACACAACTCCAA
CAAAGGAGAATAAGACAAAGGCCTGTGATGTTGGTGGCAA
CAGTATCACAAGTCCTCAAAAACGAACCAGAAACAACACT
GATGTGGTTGCAGAGGCCAGTCCACGAAAGTCAAGTCGCC
TGGTGAGTGCAGCTCCGGTTGAGGCTAGTCCACGAAAATC
AGCTCGCGTGTTGAACACTCCACAGAAAACTCAGCCTGTA
GTGTCCAGCCCCAGAAAGCACGCCAGACTGACCAGTGCAG
AGACTCCGGAGAGCAGTCCTAGAAAGTCAAGTCGCTTGGA
AAATGTTACTCAGAAAGCTGCTAGCCAAACAGAAAGCCCA
AGAAAGCCAGGAATGTCTACACCCACATCAAAACAGGCTA
AATGTGAGAGCCCAAGAAAACAGAGCAAACAGAGCACCGC
CAAAATGGAGAAAAGCACACCTCGGAAAACTACCAAAGCC
AAACTTCAAGTTCCTCAGGAGCCGGTGAGTCTGACACCTC
TTCATGTCCTGCAGTGTCACAGTCGACAGAACGATCCAGA
CGACTTCAGCACTCAGCTTTGGGCCTGTGCTTTTGAGCCC
CAGCAGGACGACAGTATCGATATCAGTGGTGGCTCTCAGA
CAATTGCCACATGTGGAGGAGAAACTTTGTGTGTGATCAA
CTGTGAGTCAGGACTGGTGCTGAAGAAATACAAGGTTCCT
GGTGAGGATTTTTTCTCTTTAGCCTGGTCCACTGTGCTGA
TGTCCAGAACAGGTGGCTCTGCCCGTCCCTGCAATATCCT
GGCTGCTGGAGGAAAGAGAGGTTGTGTGAAGCTCATCCAT
CCCCGAGTCAACCTGGCATTTGGAGAGTTTCGCGTCAGTC
GACGTGCCATTTCCATAATGCGCTTCAATCCACGCAAACC
CACCTTTCTCTTCACTGGGACGTATGATAAAAAGATCTTT
TTGTGGGACATTGGTGGACTGGATCAGGATTACAACTTTA
AAATCAGTAAGCTGCTAACACTGGAGACGAGCTCCACTCC
TCTTCATCTCGCTCTGCTCCCCTCGTCCCCAGACACACAT
CTGCTTTCAGGCTGTGATGAAGGCCTGTATTGCTTTGACG
TCCAGCTCAGTAAAAACACACTGAAGAGAAATGAAGAGAT
TGAGATCGTATTTCCAATTTACAAGAAAAATGACAAGAAA
AACAACTACCGGACTATTGATGGATTGAGCTTCCTTTCTG
ATGATGTAGTGGCATCCAAGAGCCACATGCAGGGCTCAAT
CTACCTGTGGAGCTGGAGTGCCACACGGGCATCATGGAAC
AGCAGAAAGAAAGAGGTGCCGGCTGTTATTCTGGCAGAGC
TGCAATGGTCCAGTACTGACATCCCATACCTGTCTCTAGG
CACCTGTCCAGGTTATGGTTATGTAGTATGTGGAGATGAG
CAAGGCAGACTATGGATGTATCATATTACAGACACCATGA
TGGAAAACTTCAAGAGTGGAAAAACAATCTCAGCCACTGA
GGTGCTGCAGTGGCCGTCACCTATCAGAGCTGGAAAGGGT
GCTTTAGAGGGGCCGTCTATTAACAGCACCGCCATGGATC
CTGGTCTCCATTATTTGGTGGCCCTTACAGACAAGAACAT
GGTTGTGGTTTGGAAAAGAGAGAGTCACTGAGTTTTTTGC
GGTTTGTTTTTGCAACTCGACTTGAATTGTAATCATGGTT
TTGTGAGGAGAACATGACTTGAAAGGGAAATCGCAGACTT
CAACTGTTACAAAGACTTATTGTCTTAAAGAGACAGAGAA
AGACTAATTTGAGCCATCATGTGGATTTATTCCTGTTGCA
CTGTCACAAATGTAATTTAGCAAAATCACTCGGAATTTCT
TTACTTCAAGTGTTTTTATTGTTTGTTTTAGTATTTTTTT
TAATTCAAATTCAGAAAAAAAAAGATTGTCGGTTAAAAAT
GACATTGTTCAAAACTGTTTTTTCCTAATAAACTGGTGTC
ATACATCATATTTCTTTTTA

lrwd1 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA lrwd1-201 2660
ncRNA lrwd1-002 (1) 665
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
lrwd1-201 Contained in:
[BAC] DKEY-261J4 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000022783 (1),  Ensembl_Trans:ENSDART00000050906 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC095309 (1) 2692 bp
GenBank:CV105806 (1) 839 bp
GenBank:CV482173 (1) 807 bp
GenBank:CV109176 (1) 795 bp
GenBank:DV594789 (1) 756 bp
GenBank:BI673712 (1) 668 bp
GenBank:CK693686 (1) 645 bp
CITATIONS (2)