ZFIN ID: ZDB-TSCRIPT-090929-6040
Transcript Name: pex12-201
Previous Name: pex12-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000022779 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000022779|OTTDARG00000018719|ZDB-GENE-040426-929 pex12|OTTDARP00000019037 DKEY-261J4.6-001 LG_ AL935280.12 Danio rerio protein_coding KNOWN, 1406 bp
TCTGACAGGGAAAAAAAAGTGTTGCGACAGATGATGACCG
TTGACCAGTGCGTTGATTTCCAGCACTGTAACTCTCCTGA
ATTATTTTGTTTGGTAAAATGAGCACCATTGTCCTCATTA
AAAGGCTCGACTGACGTACCTGTAGGAAGGCGTTATTGTT
GTTTGCAGTAGTTTTCCTCATCAGGTGTGATGGCGGAGCG
AGGAGCTCATTTAACCACAGCTGCCCCGGCTGAAGATCGA
CCCTCAGTGTTTGAGGTTTTAGCGCAGGACTCTTTAATGA
CCGCTGTCAAACCCGCTTTACTGCATGCTGTCAAGATTCT
CGCTACATCTAACCCTGCCCGCTATGGAGTTCTCTGGAGG
AGGTTTGATGAGATTTACGTAATCCTGGATATGTTATTGC
AGCATCACTTCCTGTCCCGCACCAGCGCCTCATTTTCAGA
GAACTTCTATGGCCTGAAGCGTGTGGGATCACATAGTGCC
CGTGCTGCCCATTTGGGACTGCGGCGGAGGCAACACTGGC
GCTCTTTACTCCTGCTGGCCCTCATTCCATACCTGCACAC
CAAACTGGAGAAAATCCTGGCGCGACAGAGAGACGAGGAC
GATTTCTCCATCCGCTTGCCGCAGTCCTTCCTGCAGAAGA
TGTACAGGGCGTTTTTGGCTGCGTATCCTTTCGTGTGCAT
GGCGTGGGACGGCTGGGTCTTCTGCCAACAGCTTTTGTAC
GTTTTCGGCAAAACACGGACACATTCTCCACTTCTGTGGC
TTGCCGGGGTTAAACTGTCATATCTCACGGCTAATGACAT
ACACAGTCTGGATCTCAAGCCTTCAGGCCCAGAATTGAGC
TCCGGTCAAAGCTTTGGAGAGAAATTACAGCGAGTGGTCT
CGACGGCGGTCGGTGGTGTGGCGGTGTCTCTGTCCACCAG
CTTGTCGATTGGCGTGTTTTTCCTGCAGTTCCTGGAATGG
TGGTATTCGTCGGAAAACCAGAGCACCGTGAAGTCCTTGA
CCTCCCTCCCGACACCTCCTCCCCCCCTCCACCTTCACAG
CCAGGAGACGTCTCACACACACATCAAAGTGTGTCCGATC
TGCAGGAAAGTGCGCACCAATGACACCGCGCTGGCCACGT
CCGGCTACGTGTTCTGTTACAGGTGTATATACGTGTACGT
GAAAGCCAACCACAGGTGTCCCCTCACCGGCTACCCTTCA
GAACTGCAGCACCTCATTAAAATATACACCCCTGACGGAT
AGACTGGTCATATTTCAAGATGCCCTTATGTGAATGCCCG
AATTTATATAAATATTGCAAAGTGTTCAGATAACTGCTAT
TTCAAATGTGACCAAAATCTAAATCTGTAATGTGGTTTGA
ATAGACTACTAATTTATAAATAGTAATAAATTTGTACAGA
AATCAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
pex12-201 Contained in:
[BAC] DKEY-261J4 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000022779 (1),  Ensembl_Trans:ENSDART00000050912 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC045976 (1) 1413 bp
GenBank:AY391447 (1) 1384 bp
GenBank:CK870701 (1) 949 bp
GenBank:CF998643 (1) 788 bp
GenBank:DT069810 (1) 731 bp
CITATIONS (2)