Transcript

drl-201

ID
ZDB-TSCRIPT-090929-6037
Name
drl-201
Previous Names
  • drl-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000022776 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000022776|OTTDARG00000018716|ZDB-GENE-991213-3 drl|OTTDARP00000019034 drl-001 LG_ AL935280.12 Danio rerio protein_coding KNOWN, 1862 bp
AAGAAACGAGTATCAGTAGGATGCAGACGATTGATAGTGC
AGCCATTGCAAAACTTCACCCTAACCGACTCACTCAAAAC
ACAGAATCATTCAGTAAGGAACTGCTGTGTGTTGCTCAGA
GACAATTTTGCATCTAAAATAACTACCACTCAACGATCCC
AATTCACACTTGGAAATAGAGAAAAGCGTGAAGATGAAGA
ATACAACAAAACCCTGCAGAACAGAGCATCACAATGCTGA
AGGACAAAGAGATCGCATGGAGGGAAACAAGAAAGGAGAA
ACAAAGGCCAAAAAATCAGTCGCCTGCTCTCATTGCAAAA
AACGATTCTCACATAAAGCGCACCTTCAGATTCACATGAG
AGTTCACACTGGAGAGAAGCCATATCGATGTGATCAATGT
GGGAAATGTTTCCCATACAAACAAAGCCTTAAACTACACC
TGGATATCCATGCCAAGGGGAATCCATACACGTGTGATGA
GTGCGGGGAGAGTTTCAAAACCAGGTTACAATTGAGGAGC
CACATGACACTCCACCCTAAATACAAGCCGTACAAATGTG
ATCAATGCGAGAAGAGTTACGGGAGAGAAGACCACCTTCA
GAGACACATGAAGCTTCACACAGGGGAAAAGCCGCACAAG
TGCGAACACTGCGGAAAGAGTTTCCCGATGAGAGATTTGC
TTAGGAGCCACTTAATGGTGCACAGCGAAGTGAAGCCGTA
CACATGTGATCAATGCGGAAAGGGTTTTACACTCAAAAAA
AGCTATAATGAACACATGAATATTCACACTGGAGAGAGGC
CGTACACATGCGATCAATGCGGGAAGGGTTTCCCTTATGA
ACAGAGTCTTAATCTGCACATGAGATTTCACCGAGAAGAA
AAACCCTTCACTTGTGATCAATGCGGCCAGAGCTTCTCAC
AGAAAGGAGCCTATAACATCCACATGAAAATCCACACTGG
AGAAAAGCCGTATACCTGCGATCAGTGCGGGATGAGTTTC
AGACATGGATACTCTCTCAAATTACATATGACGCACCATA
CTGGAGAAAAACCATTTCACTGTGATCAATGTGATAAATG
TTATAGTACGGCATTATTCCTGAAGAACCACATAAAAACT
CATGATAAGGCTCAAATTTACTCATGTTTAACTTGTGGAA
AGACTTTTAATCAGTTGAGGGGTTTGAGGTTGCATGAGAA
AAGGCACAGCCTTACAAAGCCTTTTATGTGCTTTGATTGC
GGAAAGTGCTACTTTACAGATACTGAGCTGAAACAGCATC
TGCCAGTTCACTCTAATGAAAGACCTTACATGTGTTCACT
CTGTTTTAAGAGTTTCCCCAGAATGGGAAGCTTGATAGTT
CATGAGAAGACCCATAATGGAGAGAAACCCGATTGCCGCA
CTGGAAGTAAAAAGAGCCAGGATGAGTGAGAGCATAATGA
AACATCTTTATTAAATATGTTTGCTTTTTGATATAAACTT
TATCATGAAGCTTGTTTGTTTTAAGGTCAGGTATTCTGTG
ACACTATTACTCGGGGATAGTTTATAGTCTTTTATTGAAG
TAGTTGTTTACAAAATGTTCTTGTCAATTAACTTTGTAAC
TTGCTAACAATTATATTCCTTTTCTTTTAACTTTTAAATG
TTATGAATCTTTCTCAATTGTTTTAACTGTTTTTTATAGG
CTTATATATTCTCTTTAGCTCATATATTCTGTTTAGTATA
TATTGAATTCCCTCTTTTTGTGCTTTTTTTAATTCAACAT
TAAGAATTTTACAGAAACAACTTGATAATGCCAGTCAATA
ACAGTTTAAGAAATGCATCTAACTTGTATCTTAGAAAAAG
AATAAAGTTCTTAAACACCTAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations