header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-6037
Transcript Name: drl-201
Previous Name: drl-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000022776 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000022776|OTTDARG00000018716|ZDB-GENE-991213-3 drl|OTTDARP00000019034 drl-001 LG_ AL935280.12 Danio rerio protein_coding KNOWN, 1862 bp
AAGAAACGAGTATCAGTAGGATGCAGACGATTGATAGTGC
AGCCATTGCAAAACTTCACCCTAACCGACTCACTCAAAAC
ACAGAATCATTCAGTAAGGAACTGCTGTGTGTTGCTCAGA
GACAATTTTGCATCTAAAATAACTACCACTCAACGATCCC
AATTCACACTTGGAAATAGAGAAAAGCGTGAAGATGAAGA
ATACAACAAAACCCTGCAGAACAGAGCATCACAATGCTGA
AGGACAAAGAGATCGCATGGAGGGAAACAAGAAAGGAGAA
ACAAAGGCCAAAAAATCAGTCGCCTGCTCTCATTGCAAAA
AACGATTCTCACATAAAGCGCACCTTCAGATTCACATGAG
AGTTCACACTGGAGAGAAGCCATATCGATGTGATCAATGT
GGGAAATGTTTCCCATACAAACAAAGCCTTAAACTACACC
TGGATATCCATGCCAAGGGGAATCCATACACGTGTGATGA
GTGCGGGGAGAGTTTCAAAACCAGGTTACAATTGAGGAGC
CACATGACACTCCACCCTAAATACAAGCCGTACAAATGTG
ATCAATGCGAGAAGAGTTACGGGAGAGAAGACCACCTTCA
GAGACACATGAAGCTTCACACAGGGGAAAAGCCGCACAAG
TGCGAACACTGCGGAAAGAGTTTCCCGATGAGAGATTTGC
TTAGGAGCCACTTAATGGTGCACAGCGAAGTGAAGCCGTA
CACATGTGATCAATGCGGAAAGGGTTTTACACTCAAAAAA
AGCTATAATGAACACATGAATATTCACACTGGAGAGAGGC
CGTACACATGCGATCAATGCGGGAAGGGTTTCCCTTATGA
ACAGAGTCTTAATCTGCACATGAGATTTCACCGAGAAGAA
AAACCCTTCACTTGTGATCAATGCGGCCAGAGCTTCTCAC
AGAAAGGAGCCTATAACATCCACATGAAAATCCACACTGG
AGAAAAGCCGTATACCTGCGATCAGTGCGGGATGAGTTTC
AGACATGGATACTCTCTCAAATTACATATGACGCACCATA
CTGGAGAAAAACCATTTCACTGTGATCAATGTGATAAATG
TTATAGTACGGCATTATTCCTGAAGAACCACATAAAAACT
CATGATAAGGCTCAAATTTACTCATGTTTAACTTGTGGAA
AGACTTTTAATCAGTTGAGGGGTTTGAGGTTGCATGAGAA
AAGGCACAGCCTTACAAAGCCTTTTATGTGCTTTGATTGC
GGAAAGTGCTACTTTACAGATACTGAGCTGAAACAGCATC
TGCCAGTTCACTCTAATGAAAGACCTTACATGTGTTCACT
CTGTTTTAAGAGTTTCCCCAGAATGGGAAGCTTGATAGTT
CATGAGAAGACCCATAATGGAGAGAAACCCGATTGCCGCA
CTGGAAGTAAAAAGAGCCAGGATGAGTGAGAGCATAATGA
AACATCTTTATTAAATATGTTTGCTTTTTGATATAAACTT
TATCATGAAGCTTGTTTGTTTTAAGGTCAGGTATTCTGTG
ACACTATTACTCGGGGATAGTTTATAGTCTTTTATTGAAG
TAGTTGTTTACAAAATGTTCTTGTCAATTAACTTTGTAAC
TTGCTAACAATTATATTCCTTTTCTTTTAACTTTTAAATG
TTATGAATCTTTCTCAATTGTTTTAACTGTTTTTTATAGG
CTTATATATTCTCTTTAGCTCATATATTCTGTTTAGTATA
TATTGAATTCCCTCTTTTTGTGCTTTTTTTAATTCAACAT
TAAGAATTTTACAGAAACAACTTGATAATGCCAGTCAATA
ACAGTTTAAGAAATGCATCTAACTTGTATCTTAGAAAAAG
AATAAAGTTCTTAAACACCTAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
drl-201 Contained in:
[BAC] DKEY-261J4 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000022776 (1),  Ensembl_Trans:ENSDART00000097364 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC095019 (1) 1896 bp
GenBank:AF157109 (1) 1848 bp
GenBank:BQ169347 (1) 1848 bp
GenBank:CN506609 (1) 809 bp
GenBank:CV103583 (1) 787 bp
GenBank:CN022299 (1) 763 bp
CITATIONS (2)