Transcript

wdfy3-201

ID
ZDB-TSCRIPT-090929-5788
Name
wdfy3-201
Previous Names
  • wdfy3-001
  • si:ch211-259k10.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000022442 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000022442|OTTDARG00000018482|ZDB-GENE-070705-153 wdfy3|OTTDARP00000018804 CH211-259K10.1-001 LG_none FP017212.4,BX537300.6,BX571674.7 Danio rerio protein_coding NOVEL, 1158 bp
GGCTGGCTTCGGCCTCAAGAAGCCTCTAAAGATGAATATG
GTGAAGAGGATCATGGGAAGGCCACGGCAGGAGGAGTGCA
GCCCACAGGACAACGCGCTGGGACTGATGCACCTGCGCCG
CCTCTTCTCTGAGCTCTGCCACCCGCCGCGCCACATGACA
CAGAAAGAGCAGGAGGAGAAGCTTTATATGATGCTGCCTG
TTTTCAATCGGGTGTTTGGGAATGCTCCACCGAGCACCAT
GAATGAGAAGTTTTCAGACCTGCTGCAGTTCACCACACAA
GTGTCCAGACTTATGGTGACTGAGATCAGACGGAGGGCAT
CCAATAAATCTACAGAGGCAGCCAGCAGAGCCATTGTGCA
GTTTCTGGAGGTAAATCAGAGCGAGGAGACGAGTCGGGGC
TGGATGCTCCTGACCACCATCAACCTGCTGGCCTCCTCAG
GACAGAAAACTGTGGACTGTATGACAACAATGTCAGTGCC
CTCGACGCTGGTGAAATGCCTGTATTTGTTTTTTGACCTG
CCCCACATGCCTGAGGTTCCTGCTGCCACCCAGACCGAGC
TTCCTCTGGCGGATCGCAGGGCTCTTCTGCAGAAAGTCTT
TGTCCAGATCCTGGTGAAGTTGTGCAGTTTCGTGTCTCCA
GCAGAGGAACTGGCCCAGAAGGATGACCTCCAGCTGCTCT
TTAGTGCCATCACCTCCTGGTGCCCCCCACACAATCTGCC
CTGGAGGAAGAGCGCCGGAGAAGTGCTCACCACCATCTCC
CGACATGGCCTCAGCGTCAATGTTGTCAAGTACATCCACG
AGAAAGAGTGCTTATCAACATGCATCCAGAACATGCAGCA
GTCAGATGACCTTTCTCCTCTGGAGATTGTGGAGATGTTC
GCTGGGCTCTCCTGTTTCCTGAAGGACTCGAGTGATGTCT
CTCAGACACTGCTGGATGACTTCCGCATGTGTCAGGGCTA
CACCTTCCTCATAGATCTTATGATCAGGTTGGAGCAGGCC
AAAGAGGATGAATCCAAAGATGCTCTAAAGGACCTGGTGA
ACCTGGTGACCGCTCTGACCACATATGGTGTCAGTGAGCT
GAAGCCAGCTGGACTTACCACCGGAGCACCCTTCCTGCTT
CCAGGTTTTGTGGTTCCACAGCCTTCTGGGAAAGGTCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations