ZFIN ID: ZDB-TSCRIPT-090929-5727
Transcript Name: taf1-001
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000022372 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000022372|OTTDARG00000018413|ZDB-GENE-030131-5576 taf1|OTTDARP00000018755 taf1-001 LG_ BX005407.5 Danio rerio protein_coding KNOWN, 6220 bp
AGTAGCAGTCTACTCGGTGCCGCTGGATCTCTAAACCTGC
AGGGGGAGCCAGACAAACTGGATCATATCCTCTGACGAAC
ACAACAAACAGAAGCACACCGCTGCTTCTGCCCGCGCATG
CAGCAGCAGCTTATTCATTAAAAAGCCGTTTCATTTATTT
GAATGTATTTATTTGCTGATTAAACAACATACGCTTGCGT
TTATACATATTAAACGCGATCATTTTTGCGCGCATGTCTT
TGCGCGGCCCCTTTTTGCTCGCTGCTAACAGCTAACTGAC
TGGCCGGGGCAAGGAAGCTCCTCCTGGGATCCGATTCCCA
CTCGAGCCCGAGGAGCCAGAGGCCTTCGTGCCGGTTTACT
TCAAGAGGAGAGCAGAATGTCAGACTCGGACAGTGATGAG
GATCAGGATCGGCCCTTCCACTTGACAGGGTTTCTTTTTG
GCAACATTAACGAGAATGGACAGCTGGAAGATGACAGTGT
GCTGGATACGGAGTCAAAGAAGCATTTGGCTGGTCTGGGA
ACGCTGGGTTTGGGTTCACTCATTACAGAGATCACAGCCA
GCGAGGAGGAAACAGCCGAGCAAGAGCAAGATCAGAGCAG
CACTGACGCAGAAGGATGGGTGAGGAGCACTGAAGATGCA
GTTGATTACTCTGATATCAGTGAAGTTGCCGAGGATGAAA
CTCGCAAATACAGACAGGCCATGGGCAACCTGCAGCCCTC
GCGGAGAACAGATGACGAGGATGACTATGATGCTGATTGT
GAGGATGTTGATTCCAAACTCATGCCACCTCCCCCTCCCC
CTACTCAACCAATCACGGCGAAGAAAGATGACACGCCCAC
TCAGAACAGCAGTGTGACTGATGAGGGAGATGGTATCATC
CTGCCTTCCATTATTGCTCCGTCATCTGTGGGTGATAAGG
TTGATTTCAGCAGTTCATCGGACAGCGAGAGTGAGAGCGA
TCGACCTTCTCAGGGTTCAGGGACAGGGAAAAAGGCAGGG
TGTCTCACCCTCCCTCTCGCAGGGATTATGCAAAAAGATG
CTGCCAAAGCCCTGCCTGGAGTCACTGAGCTCTTTCCTGA
GTTCAGACCTGGAAAGGTGTTGCGGTTCTTGCGGTTGTTT
GGTCCTGGAAAGAACATGCCATCTGTATGGCGAAGTGCGC
GCAGGAAGCGAAAACGAAAGCAGAAAGAGCCACAGTCTGA
CATGGCAGCTGCGGGTGACATTGAATCACTGCCATCTGAA
CCAGGGGCTAAGAAAAAATCAGGGTGGGACTATGAGTATG
CACCGCCTCCACCCCCAGAGCAGTGTCTGTCTGATGATGA
GATCACCATGATGGCTCCGGTGGAGTCTAAGTTCATGCAG
GTGTCTGGTGAAGGTGATAAAGTGTCTGAGATGAGGCCAA
AGGTGGCTGAGTGGCGTTATGGTCCAGCACAGCTTTGGTA
TGACATGCTTGGTGTCCCGGAGGATGGCAGCGGCTTTCAT
TATGGATTTAAGCTGAAAGATGACAAACAGGAAGACAACA
CTGATGCAGTGACAAAAATGGCAACTCCTCCAGCTTCTGA
ACCAGTGCCTGAGCAGGAACCACCACAAGAATCACAAGAT
AAGGCGGATGAGGATGCTCCAATGCAGGATGAGCTGTTTT
TAATGGTGACCCAACTGCAGTGGGAGGAAGACATTATCTG
GAATGGAGAGGATGTAAAACACAAGGGCACTAAAACTCAG
CGTGCTAGTCTGGCTGGGTGGCTGCCTACTAGCATGACCC
GAAACGCCAATGCTTACAACGCTCAGCAGGGTCTAAGCCG
CAGTAATTCTCAGTTGGTGCCCCCAACCCCTCCTCCTTTG
ACCAAAACTCCATCCATAACAGGATCCAAGAGAGACAAAC
ATAATCATGATCATCAGGTTTCTCATGAGGATGACACCCC
ATGGTTCTCAATATTCCCAATTGATAACGAGGAGCTTGTT
TATGGACGTTGGGAAGACAACATCATTTGGGATGATCAGA
ACATGGACTGTATCCCTTCACCTCCTGTTCTCACCCTTAA
CCCCAATGATGAGAACATCATACTAGAGATCCCAGATGAA
AAAGAGGAGAGAACCTCACATTCACCCTCCAAAGAAAATA
AAAAAGAGACAGCATTGAAAAAAAGTCGCATTCTGCTGGG
AAAGACTGGCGTCATCAAAGATGAACCCCAACAGAATATG
TCCCAACCGGAGATCAAAGATCCCTGGAATCTGTCCAATG
ATGAGTTCTACTACCCCAAACAGCAGGGCCTCAGGGGCTC
ATTTGGCGGAAACATCATTCAGCACTCCATTCCTACGGTT
GAGTTGAGGCAGCCGTTCTTCCCCACTCACATGGGACCCA
TGAAACTACGACAGTTCCATCGACCTTCTCTGAAGAAGTA
CTCATTTGGAGCACTGTCCCAGCCTGGTCCGCACGCAGTC
CAACCACTTCTCAAACACATCAAGAAAAAGGCTAAGATGC
GAGAACAGGAGCGGCAGGCATCAGGTGGAGGGGACATGTT
CTTTATGCGCACTGCTCAGGATCTGACAGGCAAAGACGGA
GACCTGGTTTTGGCTGAATACAGTGAGGAGTATCCTCCTC
TTCACATGCAAGTTGGCATGGCATCTAAGATTAAGAACTA
TTACAAAAGAAAACCAGGTAAAGACCCAGGCGCACCTGAC
TGTAAATATGGAGAGACCGTTTACTGCCACACTTCACCAT
TCCTTGGATCATTGCACCCTGGACAGCTGCTACAGGCATT
TGAAAATAACTTGTTTAGAGCTCCCATATACCTTCATAAG
ATGCCTGAGACAGATTTCCTCATTATCCGGACGAGGCAGG
GTTACTTTATCCGGGAGCTTGTGGACATATTTGTTGTGGG
TCAGGAGTGCCCTCTTTATGAGGTGCCAGGGCCCAACTCT
AAACGAGCCAACACACACATTCGAGATTTTCTTCAGGTTT
TCATCTATCGTCTGTTCTGGAAGAGTAAGGATCGTCCTCG
CCGCATTCGTATGGAAGACATAAAGAAAGCGTTTCCATCT
CACTCTGAAAGCAGCATCCGCAAACGCCTCAAACTCTGTG
CTGACTTTAAACGCACAGGCATGGACTCTAACTGGTGGGT
GCTGAAACCTGATTTCCGGCTTCCGACTGAAGAGGAGATC
AGAGCGATGGTCTCCCCAGAGCAGTGTTGTGCATACTACA
GTATGCTGGTGGCAGAGCAGAGGCTGAAGGATGCTGGTTA
TGGTGAGAAGTCTTTCTTTGCACCCGAGGAAGAGAATGAG
GAGGAATTCCAGATGAAGATTGACGATGAGGTACGCACTG
CACCATGGAACACAACTCGGGCATTTATTGCAGCCATGAA
GGGCAAGTGTCTCCTGGAGGTCACAGGGGTTGCTGACCCT
ACCGGGTGTGGAGAGGGATTCTCATATGTTAAAGTCCCTA
ACAAACCTACGCAGCAGAAGGATGATCGAGAGCCTCAGCC
AGTAAAAAAGACAGTAACTGGGACTGATGCTGATCTGAGA
CGCCTATCACTCAAAAATGCCAAGCAGTTGCTTCGCAAGT
TTGGGGTTCCTGAAGAAGAGATAAAGAAACTGTCCCGTTG
GGAGGTTATCGATGTCGTGAGGACCATGTCTACTGAGCAG
GCTCGTTCAGGGGAAGGACCAATGAGTAAATTTGCTCGTG
GGTCTCGATTCTCTGTAGCCGAACATCAAGAACGTTACAA
AGAGGAGTGCCAGAGGATCTTTGACCTGCAGAACAAAGTA
CTAGAGTCCACAGAGGTGTTATCGACAGACACAGACAGCA
GCTCAGCGGAGGACAGTGATTTTGAGGAGATGGGCAAGAA
CATCGAGAACATGCTGCAAAATAAGAAGACCAGCTCTCAG
CTGAGCAGAGAGAGAGAAGAGCAGGAGAGGAAAGAGCTGC
AGCGAATGCTGATGGGAGAGGACAACGAGAGGGAGAGGGG
CCGCAAGGAGAGACGCAAAGGCTCGAGTGCCCTCTCCACC
AGCTCTCACAAAGATGATGACGCTTCCTCCGTCACTAGTC
TGAACTCCTCAGCAACAGGGCGAAGGCTGAAAATCTATCG
CACCTTTTGTGATGAGGATGGCAAGGAGTATGTGCGCTGC
GAGACTGTACGCAAACCGGCTGTTATTGACGCTTATCTGC
GTATACGCACTACTAAGGATGATGAGTTCATTCGCAAGTT
TGCTTTGTTTGATGAGCAGCACAGGGAGGAGATGAGAAAG
GAACGGCGCAGAATTCAGGAGCAGCTCCGACGCCTCAAAC
GAAACCAAGAGAAAGACCGATTTAAAGGACCACCTGAGAA
AAAGACCAAGAAGGCTAAAGAACGACCAGACCTGAAGCTG
AAATGTGGAGCTTGTGGTGCAATTGGCCATATGAGAACCA
ACAAGTTTTGCCCGCTGTACTACCAAACCAATGCTCCCCC
CTCCAATCCGGTGGCTATGACAGAGGAACAGGAAGAGGAG
CTTGAGAAAACTGTAATCCACAATGATAATGAAGAACTCA
TTAAAGTAGAAGGAACCAAGATTGTGCTTGGAAAACAACT
CATTGAGAGTGCTGATGAAGTGCGGAGGAAATCTCTGGTT
CTGAAGTTCCCCAAGCAGCAGCTTCCTCCTAAAAAGAAGA
GGCGTGTGGGGACAACGGTGCACTGTGACTACCTCAATCG
GCCTCATAAGTCTATTCACCGCAGGAGGACAGACCCCATG
GTCACGCTTTCTTCGGTCCTGGAGAGCATCATTAATGACA
TGAGGGATCTTCCAAATACGTACCCGTTTCACACTCCTGT
CAATGGCAAAGTGGTCAAGGATTATTACAAGATCATCACA
CGGCCGATGGATTTGCAGACGTTACGTGAAAACGTTCGCA
AGCGCATGTACCCTTCACGAGAGGAGTTCAGAGAAAGCGT
TGAGCTCATCTTCAAAAACAGTGCTACTTATAATGGTGCC
AAGCATCCTTTAACTGTTGTTGCTCAAGCAATGCTGAGTC
TGTGTGTTGAAAAGATCAAAGAGAAAGAGGAGCGTCTTGT
TCGATTGGAGAAAGCCATTAATCCTCTTCTGGATGACGAT
GATCAAGTTGCTTTCTCTTTCATCCTCGACAACATTGTCA
CACAGAAGATGATGGCCGTACCTGACTCTTGGCCTTTCCA
TCATCCAGTTAACAAGAAATTTGTTCCTGACTATTATAAA
GTCATCATCAACCCCATGGATCTGGACACACTCCGTAAGA
ACATCTCCAAGCACAAGTATCAGAATCGAGAGGTGTTTCT
TTCAGATGTGGGTCTCATTCACACCAACAGTGTCAAGTAT
AATGGTCCTGATAGTCCTTATACAAAAACTGCTCTGGAAA
TTGTGAACGTTTGCAAGCAGACTTTAGCGGAGTATGATGA
ACACCTGACTCAGCTGGAGAAAGACATCCTTACTGCTAAA
GAAGCTGCTCTGGACGCTGCAGACCTTGAGAGTTTAGATC
CATTAACTCCAGGGCCGTATACACCGCAGGGTCGACACAG
AGGCAGATTGGGTGAAGAGGAGTCTGATGTGGACATAGAA
GGATTTGAGGAAGATGATGACGGCAAACCGAAAACACCTG
CTCCGCACTTTCAGGTTGAAGATGGAGATCTGGATGATGA
GGATGACGATGATGAAGATGATGAGCTCCTTATGCGGCCA
CCGAGGCGTATGCACATTGATGAAGATGACGACGATGATG
ATGAGGGCTCCAGTCGACCAGCACAGGCCAGTGTGCTTTA
CCAGGATCTGCTGATGTCAGATGCTGAAGATGATGCCAGT
GAGGAGGAAGGCGATAATCCATTCTCCTCTATCCAACTGT
CTGAGAGCGGCAGTGATAGTGATGCTGACCTGGGACATCA
AGAGAGTACACGGATTGGACTTGAACAGGAGGAGAGTATG
ATGTCATATGAAGGGGAGGGACCTGACGGCTTAACGCATA
TGGAGGACAGCAATGTCAGCTTTGGCAGCTATGATGATGG
AGACAGTCAGATGCAGAGGCAGGTGTCCAGCCCCAGGACG
GGAGAGCGAGATGTAGATGAGGTCTACGGGATCAGTGAGG
AGGAAGAGGATGAGGAGGAAGAGGATGAGCGCAGGAGAGG
CCCGAGTGTCCTCACTCAGGTACAGCTCAGTGACGATGAG
GAGGACAGTGAAGAATTCAGATCTGTCGGAGGAGACAGCG
ACATGGACTCTGACAACTAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
taf1-001 Contained in:
OTHER taf1-001 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000022372 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC098877 (1) 2127bp
    GenBank:BC096981 (1) 2064bp
    GenBank:BC095076 (1) 2037bp
    GenBank:BC077097 (1) 1910bp
    GenBank:CN504245 (1) 846bp
    GenBank:CO916064 (1) 810bp
    GenBank:DN856843 (1) 761bp
    GenBank:BM103990 (1) 691bp
    GenBank:BM775636 (1) 668bp
    GenBank:BM775308 (1) 639bp
    GenBank:AI883325 (1) 514bp
    GenBank:BM101762 (1) 506bp
    GenBank:BG302592 (1) 496bp
    GenBank:AL917407 (1) 488bp
    CITATIONS (1)