header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-5692
Transcript Name: shhb-201
Previous Name: shhb-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000022335 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000022335|OTTDARG00000018411|ZDB-GENE-980526-41 shhb|OTTDARP00000018720 shhb-001 LG_ BX510360.8 Danio rerio protein_coding KNOWN, 2019 bp
CGTCTGACCCTACCTCCCGTCAAACTAAGTCGCTCTTTCG
TCTCCCACTTAGCTGTGACAGCCAACCTCCAATGTGCTCA
TTCAGTGGCTATCGAGAGCGGTCGTTATTGCACCTGCTTC
GGTAGTGGTCGTTGGGCAGCATCCATCCGGTTCGCGCGAG
AAGACCCTGAGAGTGACTAAACTTTAAAGACCAGAAGAGA
TAATTCAAACGTCATGGACGTAAGGCTGCATCTGAAGCAA
TTTGCTTTACTGTGTTTTATCAGCTTGCTTCTGACGCCTT
GTGGATTAGCCTGTGGTCCTGGTAGAGGTTATGGAAAACG
AAGACACCCAAAGAAATTAACCCCGTTGGCTTACAAGCAA
TTCATCCCCAACGTTGCCGAGAAAACGCTTGGAGCCAGCG
GCAAATACGAAGGCAAAATCACAAGGAATTCAGAGAGATT
TAAAGAGCTGATTCCGAATTATAATCCCGATATCATCTTT
AAGGACGAGGAAAACACAAACGCTGACAGGCTGATGACCA
AGCGCTGTAAGGACAAGTTAAATTCGTTGGCCATATCCGT
CATGAACCACTGGCCCGGCGTGAAACTGCGCGTCACTGAA
GGCTGGGATGAGGATGGTCACCATTTAGAAGAATCTTTGC
ACTATGAGGGACGGGCAGTGGACATCACTACCTCAGACAG
GGATAAAAGCAAGTATGGGATGCTATCCAGGCTTGCAGTG
GAGGCAGGATTCGACTGGGTCTATTATGAATCTAAAGCCC
ACATACACTGCTCTGTCAAAGCAGAAAATTCAGTGGCTGC
TAAATCAGGAGGATGTTTTCCTGGGTCTGGGACGGTGACA
CTTGGTGATGGGACGAGGAAACCCATCAAAGATCTTAAAG
TGGGCGACCGGGTTTTGGCTGCAGACGAGAAGGGAAATGT
CTTAATAAGCGACTTTATTATGTTTATAGACCACGATCCG
ACAACGAGAAGGCAATTCATCGTCATCGAGACGTCAGAAC
CTTTCACCAAGCTCACCCTCACTGCCGCGCACCTAGTTTT
CGTTGGAAACTCTTCAGCAGCTTCGGGTATAACAGCAACA
TTTGCCAGCAACGTGAAGCCTGGAGATACAGTTTTAGTGT
GGGAAGACACATGCGAGAGCCTCAAGAGCGTTACAGTGAA
AAGGATTTACACTGAGGAGCACGAGGGCTCTTTTGCGCCA
GTCACCGCGCACGGAACCATAATAGTGGATCAGGTGTTGG
CATCGTGCTACGCGGTCATTGAGAACCACAAATGGGCACA
TTGGGCTTTTGCGCCGGTCAGGTTGTGTCACAAGCTGATG
ACGTGGCTTTTTCCGGCTCGTGAATCAAACGTCAATTTTC
AGGAGGATGGTATCCACTGGTACTCAAATATGCTGTTTCA
CATCGGCTCTTGGCTGCTGGACAGAGACTCTTTCCATCCA
CTCGGGATTTTACACTTAAGTTGAGACTGCTGCTGTACAT
TATCACTATGTGGGACTCAAATGTATCTTTATTTTCTGTA
AGAAAAGCCTTAAAGTGTTCATTGAATAATTTATTTCTAT
TGGATCACCTGTCTCTGGAAACGTACCCACCAATTCAAGC
ATGATGTGACCGTTTTTGTGTGCGCATTTTGTGAAACATA
CAAGAGATTATATGAGATATGAGAAAGCGCAGGGCTGTGC
AGTGTGCAGCGCTCTATTTTATCGGATAACCATAAAGGAT
GGCGCTCAAAAGTTATATTTTTGTACTCAGATTTGTATAT
TAGATTTTTGATGGCTCTAAAAGCATTTCCAGTATCACAT
TTCGTTATTTGAAATAGTGCAAAGTAAGCGTATTAAATTT
ATGTAAACACTTGGGGATGTATCAATGAACTGTTCAGGGT
CATTATGTTTAGATAGCCTATGTCAAGTGGCATTGTTTTG
ACAAACGGGTGTGTATTCATTACACTAACAGTTTTTTTGT
TTAAATGTACATTTCTTGACAGATTACTCAAAATAAATCC
ATAGTACGCAGTGTGAAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
shhb-201 Contained in:
OTHER shhb-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000022335 (1)
  • Ensembl_Trans:ENSDART00000056747 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC078321 (1) 1990bp
    GenBank:CN506187 (1) 932bp
    GenBank:DT082076 (1) 861bp
    GenBank:DN895562 (1) 757bp
    CITATIONS (2)