ZFIN ID: ZDB-TSCRIPT-090929-5640
Transcript Name: efhd2-202
Previous Names: efhd2-001, si:dkey-72l14.9-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000022248 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000022248|OTTDARG00000018357|ZDB-GENE-060531-152 efhd2|OTTDARP00000018652 DKEY-72L14.9-001 LG_ BX784025.12 Danio rerio protein_coding KNOWN, 1576 bp
CGGAGGCGTCATCATCACACGCACGAGCGCTGTCCGTTTG
AATCACGGGCTGTACAGTCGAGTATCGCTTCACACAGCTA
CAATAAAAGTCGGATGATTTGCATTTTAAAACCTATTTAA
CCACATGCTTATCTGAGTTTGGATTTAACGCACTAAACCT
TTACATGGACTGAGCGCTTTAGGGAATTCTGCGTGTTTCC
CTGGTGCATTAACCAGTAGTTAGATTGCGGATTAATACGA
AATGGCAACGGACGAGCTGTCATCGAAGCTGAACCGTCGG
CTGAAGATCGAGGATGGCTCGCACGAGCCGGCGGCGGCCC
TGGATGAGGCTCACGAGAACGGAGCGCACGATAAACCGAC
CACGAGCAGCGCGGACTCCGAGCTCGGAGCCAAACTGCAG
CGGCGCGGGGAGCTGAACGAGGGCGTCGGTGAACACCAGC
AGCCCAGCATGAAGGTGTTCAACCCCTACACCGAGTTCAA
GGAGTTCTCGAGGAAGCAGATCAAAGACATGGAGAAGATG
TTCAAACAGTATGATTCAGAGAAGGATAACTACATCGACT
TGATGGAGCTGAAGCTGATGATGGAGAAACTGGGAGCTCC
TCAGACTCACCTGGGCCTGAAGAACATGATCAAAGAGGTG
GATGAAGACCTGGACGGCAAACTCAGTTTCAGAGAATTTC
TCCTTATCTTCAGAAAGGCAGCAGCAGGAGAGCTGGCAGA
GGACAGCGGCCTTCATGTCCTGGCACGTTTGTCAGAGATA
GACGTGTCGACTGAGGGAGTGAAAGGAGCCAAATCATTCT
TTGAGGCTAAGGTACAGGCTATTAACGAATCCAACCGGTT
TGAGGCCGAAATCCGTCTGGAGCAGGAGGAGAAGAAGAAG
CAGGCAGAGGAGAAGAAACAAAGACAAGCCGCATTCAAAG
AGCTGAAGTCAGCCTTCAAATAACCGCATCCACCTCCTCC
TTTTACTCATCTACGTCTGTCTGTCATCAGAGTCCCCGCA
ATCAGAGATACTATGCAAGGCTCAAAAATCCATGCAGATT
CATCTTCCTGAGAGATCTGTTTTATCCTTGCCTCTTTCTC
TCGCTCGCTCAGGCTGATTTCGAATGTGAAGCCAGACACT
GATCTCAGTACACTGGATTGGATTAGTTTTCTTTCATTTG
CATGTGTATGTATGTCTGTTTTCACCATCAGTATCGTCAT
TTTGCATCTTGTTCTCGTTAAAGTGACCAAATTTCATTAA
ATCTAATGCTTAAGTAGTTTTAAAATAGTTTTTCTTTTAA
ATCTTTTATTGTTCTCAGTATGCCGTTTCCAATCCCCTGT
ATTCATATCAGTGGTAATTGCACTAGCGCAAAACACAAGC
AGGAAATACTTTCCGCTGTACCATGACTAATGAAACTTTC
ATTGCTGGCCATTTTAACTCGAGAGGGCAAACATCAGATC
TCTCATTCACGGATGAATTAGGAGCGTTAAGTGGTCAGTA
TTTTTTCTGAGTCGATAGACGGAGAGCTGGTTTGGGGGTG
TATGTGCATGTGTGGTGATGGTTGTAATGGTGTTTGTTTA
ATTTGCATGGTCACTG

efhd2 TRANSCRIPTS
Type Name Length (nt) Analysis
aberrant processed transcript efhd2-201 (1)    Ensembl 3101
mRNA efhd2-202 1576
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
efhd2-202 Contained in:
[BAC] DKEY-72L14 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000022248 (1),  Ensembl_Trans:ENSDART00000128829 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC146714 (1) 1618 nt
GenBank:CA975221 (1) 841 nt
GenBank:CD752612 (1) 810 nt
GenBank:DV592811 (1) 809 nt
CITATIONS (2)