ZFIN ID: ZDB-TSCRIPT-090929-5470
Transcript Name: znf451-202
Previous Names: znf451-002, si:ch211-165e15.5-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: aberrant processed transcript
Annotation Status: nonsense mediated decay
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000022028 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000022028|OTTDARG00000018212|ZDB-GENE-081107-14 znf451|OTTDARP00000038120 CH211-165E15.5-002 LG_ BX004843.10 Danio rerio protein_coding NOVEL, 551 bp
AGCCTCCAGTGTGATGAACGCAGAGGAGAAACGAGCCTCT
AGTGTGATGAACGCAGAGGAGAAACGAGCCTCTAGTGTGA
TCAACGCAGAGGAGATCTTCCCTCAGAGTAACGTTGAAGA
GGCTGAAGATGTAAATAATGCCATTGCCTCAGGTGTTCTC
GATGTTAAAAAAGAGACCACCGTTTCACAAGACGATGGTG
AAGGAGATGACGCTAAATTTGACGAGGACATGAAGCAGGC
TGTGGCCTTGAGTCTGAAGGAGGCCAGGAAAACTGCAGAT
CTGAGAACGGTGTAGAGGCTGTACTGAGAGTTTCTGTGAG
CGTCTCACTTCATGCATGAGTCAATCTGAGCTTTATTTTG
CTAGTTTGTGTAGCAGAAAGAAGATTAGTGGTGTTGAATT
GGAAGAAGCCCTGAGAAGAAGCTTGGAGGAATTCTGACAA
CATTATGATTTAGATTCAAGGTGTTTTGTTTGTTCGTTTA
GTCCGTGCACTGTATTCACGAAACATTTTATTTGTTGTTC
TTCAAAGTTAAATAAAGCAGAGTAACTCAGA

znf451 TRANSCRIPTS
Type Name Length (bp) Analysis
aberrant processed transcript znf451-202 551
mRNA znf451-203 (1) 2931
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
znf451-202 Contained in:
OTHER znf451-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000022028 (1)
  • Ensembl_Trans:ENSDART00000135523 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BI672204 (1) 558bp
    CITATIONS (2)