ZFIN ID: ZDB-TSCRIPT-090929-5469
Transcript Name: znf451-203
Previous Names: znf451-001, si:ch211-165e15.5-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000022027 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000022027|OTTDARG00000018212|ZDB-GENE-081107-14 znf451|OTTDARP00000018504 CH211-165E15.5-001 LG_ BX004843.10 Danio rerio protein_coding NOVEL, 2931 bp
CTGGTGTCCGCTTCAGATGTGTGCTTGGATTTGTGATGGA
TGTGATGCTCCAGAATCGCAGCGGTGATGTTTGAGGATCC
GGAAGATGATGTGCAGTTCGTGTCTGAGGCTCCTCTCAGA
CCAGTGCTGGAATGCATTGACCTGCTGAGTGACGGAGATG
ATGAAGACGATTTACCTGCTGCAAACACGATCGAGCAGCA
GGTGGACCGCCAGAGAGCTCATGCCGTCTCCACACTGGAC
AGACTGGCTCAGCAGGTCGCGGTGGAGAAACAGGAGAGGG
CCGAAAAGAGGAAAGCCTTCAAGGAGAAGATGATTTCGCT
GCAGGCACAAGGACGCCGCGAGCTGTCGGTCAGCCATGAT
AATAGTGCAAGCGGCGATGCCAAACGATGTGTGGATATTT
GGCTAAAAATGCCAGGACTGCAGCCGGGCTCCATTTATTC
AGGCTCTCTGTGGAAGCGCAGATCGGCTCCTCCTGCGGTG
AGATTTTCTCCTCAGAGCTGTCCGGTCATCAACTGCGGAC
GAGTCTACGACAATATTCCTCTGCTTCAGGGACATCTCAA
AAGGTTTGATCATTCACCCTGTGACCCCACCATCACCCTG
AAAGGCACCGCACCATCCATCTATGCCTGTTTGGCCTGTG
GAGAACACTTCTGCTCCCAGGAGACATGGAAACAACACAT
GCAGTCCAAGCTGTCATCGGATGGTCACCGTCGCTCTCAG
ATGTATCAGATGATCGTGGGCTTCGCCTGTCCCTCCTGCT
ACTTCCTCTTCAACAGCAAAGACGAGTGCTGTAAACACAT
GAACGCAAGAAAACACAACCGTCAAGTCATTTCTCTTACC
GAAGAGAAAGCATCAGCAGTGCCTGTTCCTGTGCCGCGCT
TCGCTAAACAGCGTCTAATCGCTCTCTGTAAAGACATCGG
CTTCAGCGTGCGATGCACAGTCTGCTCTCAGCGGCTCAAC
TCGCACATGGAGGCCACCGCACACTTCAACGTGCACTGCA
GAGACGGCTGCGCTATCGCTACCGCAGATCAAACCGTTGC
AGACATGATGAAAAAGATGGCGGTCGTCGGTCACTGCATT
TCCTGTCCTGAAGTGTTTCTGAGTTTGGATCAAATGCAGG
AGCACAAAGAGCGAATGAAACACGACGTGGAGAACATCAC
ACTCCTAGAGCGCGCACTTTTGCACTACAGCAACCACTGC
GAAACCAGAACCAATCAGAAGAGAGCGTCAAACGAAGACC
ATTCAGCCAAACGAAAGAGAGCTGAAGACTCGGATTCGCA
AGTCAAACGAGAAAGAAAGCATTCGAATGTGGCTTGGTTT
TGCGAGTGCGGCCTTCGCTTCGTTGAAGAAAACCACGCAA
AGAGACACCAGCAAGCCGCCAATCAGATCTTTCACAAATG
TGCAGTGTGCGGGAAACTAACCGGCGAATCCTCCATCGCG
CGCTTGCATATGAGTCGTTTCCATGGTGGCGCGCATCTAT
CCAACTTCCTGTTTTACTGTAGGAAGTGCAAAGTGGAAAT
GCCCAGGATGGAGGATATAATGGCGCACGTTAGCGCTAGC
CATCAAGGACACAACTACTATGAAGAACGAGAAGATAGCG
GCAGCGTAATTGATCAAATATCGGCAAAACCATCAACCAG
CAAAGAATGTGAACCAATCAGAAGCGTCTCCCCAAAAAAG
ACAGAGTCGTGGCTTTGTCGAATGTGCGAGGATTTGTTTG
ATTCGGAGAAGTTGGTACGAAAGCATTGCGGAGATTTGAG
CAGCCATAGTTTCCAGAGGTTTGCATGCGGTCACTGTCCG
CAGAAGTTCTTCAAGGACTCGACTCTACGACGACATTGCG
CTAACGAGCATAACGGTGATGTAGCGTTGCGCTACTTTTG
TGGGCTTTGCGATAGCATGCTGTTCGATACCGAAAACGAG
TTCCAGGTGCACTACGACAATCTGCACAGCCAAGATTACT
ACCGTTTGGAAACATCGACAAATCATTCGCAAAATGCACC
GGAAGTCATTGTTAATAATAGTAACACGAGCGATTCCCAA
ACATGTCTTTGCATGGGATCAAAGAAATCCAGAGAGGAAC
GGAAGCCTGTTTATACAAACTGCATGAAGCAGTTGGCTGC
TGAAAACAAATGCAGATACCGATGTCGCAATTGCGCTAAA
AGCGCTCAGAGCTACGCTGAGATGAAGACGCACATCTTGT
TGAAACACAAAGGAAATGGGAAGAGTTTTGATGTCGTGTG
CATGATCTGCTCTCAGAGTCACAAAGATGTTCCCAGTTTT
CATGCACACCATCATATACATCACTGCCAGGCAGAACCGT
GCACTTATTCCCGACCCGATGCAGAGGAGAAACGAGCCTC
CGGTGTGAACGATGCAGAGGAGAAACGAGCCTCCGGTGTG
ATCAACGCAGAGGAGAAACGAGCCTCCGGTGTGATCAACG
CAGAGGAGAAACGAGTTTCCAGTGTGATGAACGCAGAGGA
GAAACGAGCCTCCAGTGTGATGAACGCAGAGGAGAAACGA
GCCTCTAGTGTGATGAACGCAGAGGAGAAACGAGCCTCTA
GTGTGATCAACGCAGAGGAGATCTTCCCTCAGAGTAACGT
TGAAGAGGCTGAAGATGTAAATAATGCCATTGCCTCAGGT
GTTCTCGATGTTAAAAAAGAGACCACCGTTTCACAAGACG
ATGGTGAAGGAGATGACGCTAAATTTGACGAGGACATGAA
GCAGGCTGTGGCCTTGAGTCTGAAGGAGGCCAGGAAAACT
GCAGATCTGAGAACGGAATTGGAAGAAGCCCTGAGAAGAA
GCTTGGAGGAATTCTGACAACATTATGATTTAGATTCAAG
GTGTTTTGTTTGTTCGTTTAGTCCGTGCACTGTATTCACG
AAACATTTTATTTGTTGTTCTTCAAAGTTAAATAAAGCAG
AGTAACTCAGA

znf451 TRANSCRIPTS
Type Name Length (bp) Analysis
aberrant processed transcript znf451-202 (1) 551
mRNA znf451-203 2931
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
znf451-203 Contained in:
OTHER znf451-203 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000022027 (1)
  • Ensembl_Trans:ENSDART00000145867 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CD758949 (1) 840bp
    GenBank:BI429297 (1) 597bp
    GenBank:BF938793 (1) 558bp
    GenBank:BI671172 (1) 451bp
    GenBank:BG738712 (1) 363bp
    GenBank:BM316434 (1) 281bp
    CITATIONS (2)