header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-5445
Transcript Name: chrna5-201
Previous Name: chrna5-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000021963 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000021963|OTTDARG00000018168|ZDB-GENE-050417-440 chrna5|OTTDARP00000018461 CH73-235D11.2-001 LG_ CT027604.4 Danio rerio protein_coding KNOWN, 1752 bp
CGGTTGTATGTGTGTAAGCAGCCACACACATGCTGATTGG
CATGGACACACGACAACCAAATGGAAAACAGACATTCTGA
AGATTCCGCTCTCTTCCAGTCCATAATCCGATCTTCTCTG
TGGTTTTGCTGCTGCTGCTGAGGGTATCATGGTAACAGCT
CTCAGCTTGGTCAGAGCTCTCCTCCCGCTGGTCTGTTCTG
CTGTCCTGTGCTCCGCTATAGGTCCTCCTATGCTGTCCTC
CTATGCCAAGACTGAAGACAAGCTGTTTAAACATCTCTTC
AGCAACTACCAGAAATGGGTGAGACCAATCGAAGATCTAA
ACACAACTATTCAAGTAAAGTTTGGCCTGGCAATTTCCCA
GCTGGTGGATGTGGATGAGAAGAACCAGCTGATGACGACC
AATGTGTGGATGAAGCAGGAATGGACAGACTTGAAGCTCA
GATGGGATCCGGATCATTACCTGGGCATCACCTCTATCAG
GGTGCCTTCAGACTCCATCTGGATTCCTGACATTGTGCTC
TATGACAATGCAGATGGTAATTTCGAGGCCACAGTGACAA
AAGCAGTGGTGAGATTTGATGGCACAATCTCCTGGACTCC
TCCTGCCAACTATAAATCTGCCTGCACCATTGATGTGACC
TTCTTCCCCTTTGACCTTCAAAACTGCTCCATGAAGTTCG
GTTCTTGGACCTATGATGGCTCCCAGGTCGACATTCTCCT
TGAAGACGTGCATGTGGACAAACGTGACTATTTTGACAAT
GGCGAATGGGAGATCGTGAAGGCCACTGGTAACCGGGGTT
TGAGAAGAGATGGGACTTTTTTCTATCCATCCATCACGTA
CTCCTTTATAATCCGACGTCTTCCTCTCTTCTACACACTC
TTCCTCATCATCCCCTGCATTGGATTGTCTTTCCTGACTG
TGCTTGTCTTTTATCTTCCGTCTAATGGAGGGGAAAAAAT
CTCCCTCTGCACGTCTGTCCTCGTCTCACTTACTGTCTTC
CTTCTGGTGATAGAAGAGATCATCCCTTCCTCCTCAAAGG
TAATTCCTCTGATTGGAGAATATTTGGTCTTCACTATGAT
CTTCGTGACACTTTCCATTGTCATCACCGTCTTTGCTATT
AACATCCACCATCGCTCCTCTTCCACCCATCATAGCATGG
CTCCCTGGGTCCGCCGTATCTTTCTTCACCACTTGCCTAG
ACTGCTCTGCATGCGTAGCCACGTGGACCGTTACGCCACC
AGCGCTGGGACTCGAACAGGAGGACTGGGCTATGGGAAGA
GTTTGAGTCAGGATACCAACCAGCTCGATGCAGAACACAA
CCTGCAGGCGGCCTTAGAGTCTATACGCTACATCACACGC
CATGTGGTGAAGGAGAATGAAGTCAGAGAGGTTGTTCAAG
ACTGGAAGTTTGTGGCCCAGGTTCTGGACCGGGTTTTCCT
GTGGGCCTTTCTCTTAGTATCACTACTCGGCTCTGCTCTG
CTTTTCATCCCTGTTATCTATAAATGGGCCAGCATCATTG
TTCCCAGCTATGCTGAAATTACTAGCTAAACTACACGAAT
GTATACACTTCCAAACTTTTTGGCTTGAATAAAGTTTTTT
GCATTATTATAGCATTTATTACTGTAGTCTTCAAAACATC
TATGCAAATTGTGGCAATCATGCGCTGTCATTTAAGATGT
AACATGCTGCATTCTATTCTCTGTTGTATGCTGATTTCAT
TATATTAAAGTTTACAATAAAAATATGTATTG

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
chrna5-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000021963 (1),  Ensembl_Trans:ENSDART00000021372 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC092962 (1) 1740 bp
GenBank:CK698950 (1) 687 bp
GenBank:AL915157 (1) 493 bp
CITATIONS (2)