Transcript

chrna5-201

ID
ZDB-TSCRIPT-090929-5445
Name
chrna5-201
Previous Names
  • chrna5-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000021963 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000021963|OTTDARG00000018168|ZDB-GENE-050417-440 chrna5|OTTDARP00000018461 CH73-235D11.2-001 LG_ CT027604.4 Danio rerio protein_coding KNOWN, 1752 bp
CGGTTGTATGTGTGTAAGCAGCCACACACATGCTGATTGG
CATGGACACACGACAACCAAATGGAAAACAGACATTCTGA
AGATTCCGCTCTCTTCCAGTCCATAATCCGATCTTCTCTG
TGGTTTTGCTGCTGCTGCTGAGGGTATCATGGTAACAGCT
CTCAGCTTGGTCAGAGCTCTCCTCCCGCTGGTCTGTTCTG
CTGTCCTGTGCTCCGCTATAGGTCCTCCTATGCTGTCCTC
CTATGCCAAGACTGAAGACAAGCTGTTTAAACATCTCTTC
AGCAACTACCAGAAATGGGTGAGACCAATCGAAGATCTAA
ACACAACTATTCAAGTAAAGTTTGGCCTGGCAATTTCCCA
GCTGGTGGATGTGGATGAGAAGAACCAGCTGATGACGACC
AATGTGTGGATGAAGCAGGAATGGACAGACTTGAAGCTCA
GATGGGATCCGGATCATTACCTGGGCATCACCTCTATCAG
GGTGCCTTCAGACTCCATCTGGATTCCTGACATTGTGCTC
TATGACAATGCAGATGGTAATTTCGAGGCCACAGTGACAA
AAGCAGTGGTGAGATTTGATGGCACAATCTCCTGGACTCC
TCCTGCCAACTATAAATCTGCCTGCACCATTGATGTGACC
TTCTTCCCCTTTGACCTTCAAAACTGCTCCATGAAGTTCG
GTTCTTGGACCTATGATGGCTCCCAGGTCGACATTCTCCT
TGAAGACGTGCATGTGGACAAACGTGACTATTTTGACAAT
GGCGAATGGGAGATCGTGAAGGCCACTGGTAACCGGGGTT
TGAGAAGAGATGGGACTTTTTTCTATCCATCCATCACGTA
CTCCTTTATAATCCGACGTCTTCCTCTCTTCTACACACTC
TTCCTCATCATCCCCTGCATTGGATTGTCTTTCCTGACTG
TGCTTGTCTTTTATCTTCCGTCTAATGGAGGGGAAAAAAT
CTCCCTCTGCACGTCTGTCCTCGTCTCACTTACTGTCTTC
CTTCTGGTGATAGAAGAGATCATCCCTTCCTCCTCAAAGG
TAATTCCTCTGATTGGAGAATATTTGGTCTTCACTATGAT
CTTCGTGACACTTTCCATTGTCATCACCGTCTTTGCTATT
AACATCCACCATCGCTCCTCTTCCACCCATCATAGCATGG
CTCCCTGGGTCCGCCGTATCTTTCTTCACCACTTGCCTAG
ACTGCTCTGCATGCGTAGCCACGTGGACCGTTACGCCACC
AGCGCTGGGACTCGAACAGGAGGACTGGGCTATGGGAAGA
GTTTGAGTCAGGATACCAACCAGCTCGATGCAGAACACAA
CCTGCAGGCGGCCTTAGAGTCTATACGCTACATCACACGC
CATGTGGTGAAGGAGAATGAAGTCAGAGAGGTTGTTCAAG
ACTGGAAGTTTGTGGCCCAGGTTCTGGACCGGGTTTTCCT
GTGGGCCTTTCTCTTAGTATCACTACTCGGCTCTGCTCTG
CTTTTCATCCCTGTTATCTATAAATGGGCCAGCATCATTG
TTCCCAGCTATGCTGAAATTACTAGCTAAACTACACGAAT
GTATACACTTCCAAACTTTTTGGCTTGAATAAAGTTTTTT
GCATTATTATAGCATTTATTACTGTAGTCTTCAAAACATC
TATGCAAATTGTGGCAATCATGCGCTGTCATTTAAGATGT
AACATGCTGCATTCTATTCTCTGTTGTATGCTGATTTCAT
TATATTAAAGTTTACAATAAAAATATGTATTG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations