ZFIN ID: ZDB-TSCRIPT-090929-5417
Transcript Name: ing1-201
Previous Name: ing1-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000021913 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000021913|OTTDARG00000011703|ZDB-GENE-060421-4388 ing1|OTTDARP00000018421 CH211-235E18.2-002 LG_ BX537313.5 Danio rerio protein_coding NOVEL, 718 bp
CTTGGGGTTGTGCGTAGTCAACAGTCATTTTTCCTCTGTA
TTTTTCTATTCCACAATCCAAACTCCACTAAACCCATCTA
ATCCTAAAATAACATGCAGAGCATTTTAATTTCTATCCTT
CGAAATGACCGTTGAAGTCTTGCTGACAGACGCCACCACG
CGTCGTGCCACTACACTCGGTTGGAAGGTTACACATCAAC
GTCAGCGTAAAGATATTAATATTCATGAGATTTATCAACA
TCCTAAATGCGTTTGAAAAGATGCTGAATCCTTCATCAAA
CGGCGAGTCGTCTCATGTTGTGGTGAACTATGTTGAGGAG
TACCTGGAGCTGGTTGAGTCTTTGCCTTTGGACCTACAAA
GATGTGTGTCTCTTATGAAGGAAATAGACGCCAAATATCA
AGAGATCCTCAACGAATTGGATGAAGCTTATGAAAAGCAC
AGACAAGAATCCGATCCGGTCCAGAGACGTCGTCTGCTCC
ACTGCATCCAGCGCTCGTTGATCCGCACAGAAGAACTCGG
AGATGAAAAGATCCAGATCGCAGGCCAAATGGTGGAAATG
GTGGAGAACCGCAGCCGACAGCTGGAGTGGCACGGCGAGC
TTTTCCAGGCCAGTCATGACTCTCCGGAGAGCAGCGTGTC
AGTGGGCAGCACCCCGAGCGCCATAACAACCACAGCCATG
ACGACGATTTCTGATATACTGCTCTCGGCCAGTAAACT

ing1 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA ing1-201 718
ing1-202 (1)    Ensembl 1832
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ing1-201 Contained in:
[BAC] CH211-235E18 (1)

Genome Resources: Vega_Trans:OTTDART00000021913 (1),  Ensembl_Trans:ENSDART00000134646 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:DR717335 (1) 717 nt
CITATIONS (2)