ZFIN ID: ZDB-TSCRIPT-090929-2601
Transcript Name: ing1-202
Previous Name: ing1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000013659 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000013659|OTTDARG00000011703|ZDB-GENE-060421-4388 ing1|OTTDARP00000011669 CH211-235E18.2-001 LG_ BX537313.5 Danio rerio protein_coding NOVEL, 1832 bp
TGAGGTAGGTCTCCGCCATAGAATCGTCACTGGTCCTGAA
CAACTCAATACTACTACTAACACCTTAGTAACTTTTCTCA
GCAGCCTTTATTTTTTTTAAAACAAAGGCCATAGCATAGG
ATAATTATTAAAATTGATTTATCACAGATTTATCAACATC
CTAAATGCGTTTGAAAAGATGCTGAATCCTTCATCAAACG
GCGAGTCGTCTCATGTTGTGGTGAACTATGTTGAGGAGTA
CCTGGAGCTGGTTGAGTCTTTGCCTTTGGACCTACAAAGA
TGTGTGTCTCTTATGAAGGAAATAGACGCCAAATATCAAG
AGATCCTCAACGAATTGGATGAAGCTTATGAAAAGCACAG
ACAAGAATCCGATCCGGTCCAGAGACGTCGTCTGCTCCAC
TGCATCCAGCGCTCGTTGATCCGCACAGAAGAACTCGGAG
ATGAAAAGATCCAGATCGCAGGCCAAATGGTGGAAATGGT
GGAGAACCGCAGCCGACAGCTGGAGTGGCACGGCGAGCTT
TTCCAGGCCAGTCATGACTCTCCGGAGAGCAGCGTGTCAG
TGGGCAGCACCCCGAGCGCCATAACAACCACAGCCATGAC
GACGATTTCTGATATACTGCTCTCGGCCAGTAAACTAACT
GCAAATCGGAGACGAGAGGAGACCCCGAGTTCAGTTGACA
AATCTGGTGGAAAGCGTTCGAGAAGGCAGAAAAATGGCTC
AGAGAATCGGGAGAACTCTAATTACAGCTTGGAGCACATC
GAGGATGTTTCATCAGGCACGCCAAAAGAAAAGAAGCCTA
AGGCATCAGCAACATCATCCAAAAAGAAGAAGAGGTCCAA
GAGCAAGCAAGACCGAGAGCCGTCGCCAACTGACCTGCCC
ATTGATCCCAATGAACCCACCTACTGCCTTTGTGAGCAGG
TGTCCTACGGAGAGATGATCGGTTGCGATAATGACGAATG
CACTATTGAATGGTTTCACTTCTCATGTGTTGATCTGCAC
CATAAGCCCAAAGGGAAATGGTACTGTCCCAAGTGCAGAG
GAGACAACGAGAAGACCATGGACAAGGCATTGGAGAGGTC
TAAAAAGGAGAGGGCGTACAACAGGTAGTGTCAGGCGAAC
TTTCTGACATTCGAGAGTTAAGCGATCAGTTTTGAGAAGT
CTGTGATGATGTACCAGGTCAATGGTTAGTATATCTTTTA
GGGATATATTTCTGAGAGGATTCGCTCATCAGTTGTGTAG
TTATCAATGTTCTACAGCGTTAGGAGTATCCAGTTCATCC
AACAGGACAACAGTGCATTTTTATGTTCAGCTACTTGTAT
TTATGTCTTGCGTAACTGTACATATGTTCATGTGAAATAA
GCCACACAGGTCGCAGTATTGTTGCATGGCTTTTGTTCTT
TTAAAACACAAGGCCTTACAATATTGATAACGTTATGAGA
AGGTTCCATTAGTTAATGTATTTGCAACAGTATTTATTCA
TTTTTTTTTTAATATTAGTTAAGAATTACAAAGTTCATCG
GCTAAAATGTTTAATTTGTTAGCATTAGTTAAGATTAAAG
GGATAGTTCATCAAAAATGTATATTTACTCATGAATATGC
GCTCAAATGGTTCTGAACCTTTTTCTATTGTACTCAAGAG
GATATTGTGAAGAATGTTGGAAAATAACAGCCATTGACTC
TCATAGTAGGAATAAAAAAAATTGATGTCAAATGGTTTTT
ATTCTCCAACATTTTTTATTGTGTTTAACAGAAGAAAGAA
AAATCAAACCAGTTTGGATTAAATGATGGATGAGTAAATA
GCAGAAGTTTAATTTGTTGGACAAACTAATCC

ing1 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA ing1-201 (1)    Ensembl 718
ing1-202 1832
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ing1-202 Contained in:
[BAC] CH211-235E18 (1)

Genome Resources: Vega_Trans:OTTDART00000013659 (1),  Ensembl_Trans:ENSDART00000145266 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BU709697 (1) 588 nt
GenBank:BM141428 (1) 581 nt
GenBank:BM316449 (1) 443 nt
CITATIONS (2)