header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-5330
Transcript Name: lamc3-201
Previous Names: lamc3-001, si:dkey-245l10.1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000021743 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000021743|OTTDARG00000017992|ZDB-GENE-060531-121 lamc3|OTTDARP00000018286 DKEY-245L10.1-001 LG_none BX296561.8,CR762385.5 Danio rerio protein_coding NOVEL, 4942 bp
ATGGATTCCTCTGCACTTCACTCTCTTTTACTTCTGCTTT
TTGCCAGCGTCTACTTTGTTTTTGCTGGAATGGACTCTTG
TTATGATGAAAATGGTGTCCCGAGCTTGTGTTTACCTAAA
TTTGAAAATGCGGCCTTCAATCATTCCGTGATGGTTTCAA
ATATGTGCGGGATCCCACCTGAGGACTACTGCATGCAGAC
TGGGTCCACGCGCTCTTGTCATCACTGTGACGCCTTCGAC
TCTGAGCTAAATCGTAACGCCACTTACCTGACAGACTTCC
ACACGGATGAAGAGCCCACCTGGTGGCAGAGCCAGTCCAT
GTTCTATGGAGTTCAGTACCCGAATTCAGTCAACATCACT
CTGCATCTTGGGAAGGCTTTTGAGATCACCTATGTCCGTT
TAAAGTTCTACACCAGTCGACCAGAGAGCTTCGCCATCTA
CAAGCGTACAGATGAGAATGGACCGTGGCAGCCGTACCAA
TATTACAGCGCTTCCTGTCGTAAGACGTACGGAAGAGACA
ACAAGGGCTTCATACGTCCAGGTGATAACGAAAGGACGCC
ACTTTGCACGGATGAGTTTAGTGACATCTCTCCGCTGACA
GGCGGAAATGTGGCCTTCTCCACATTAGAGGGACGACCAA
GTGCCTACAACTTTGACCAGAGTCTTGTGTTGCAGGACTG
GGTGACAGCTACGGATATCCTCATCTCTCTGGACAGACTG
AACACTTTTGGAGATGAGTTCTTCAAGGATGCCAAAGTGC
TTCGCTCATATTTTTATGCCATTTCTGATTTCTCTGTGGG
GGGCAGGTGCAAGTGTAATGGCCATGCAAGCGAATGTGTG
GTCAATGAGGAAGGCCGTTCGGTGTGTGTTTGTGAGCACA
ACACCGCAGGGGTCGACTGTCAGCTCTGTGCTCCCTTCTA
CCAAGACAGACCTTGGGCACGAGCGACTGCTCATTCTGCC
AACGAGTGTGTGAGGTGTAACTGCAGTGGTCTTGCCGATG
AATGTGTGTTCGATGTGGAACAGTACCGCAGCACAGGACA
AGGGGGGCGCTGTCTCGGCTGTAGGGAAAACACTGCTGGT
CCTCATTGTGAGCAGTGCAGAGAAAACTACTTCAGATCAT
CAGCACTGCAGCCCTGCCAAAACTGTAACTGCAATGCATT
AGGCTCTGTGAGTTTGCAGTGTGATGCGGATGGAGTGTGT
GTTTGCTGGCCAAGTGTGTCTGGTGTGAAGTGTGACATTT
GCAAGTCTGGCTTCCATTCTCTTGGCCCTGGTGGATGCAG
GTTGTGTGACTGTGATGAGAGGGGCAGTGTAGGAGTGTGT
TCAGCTGAAGACGGACGCTGCCACTGCAAAGCGAATGTGG
AGGGACAGTCCTGCAACAGGTGTAAGCCAGGATCCTTCAA
CCTCCAGCTGGAGAATCCAGACGGCTGTAATAAATGCTTT
TGCTTTGGTCACTCCCTCGCCTGTTTCTCCTCCAATCAGT
ACACGCCAATTTATATCACTTCAGACTTTCTAGAAGATCC
AGATGGCTGGAAGGGTGTTTTCTCCAGAGCCCATGAACAA
TCTCTGATCTGGAAGGAGGGAGAAGTCTATCTGTTGCCCT
ACCGAGAGGAGAACGGCTTCTACAAAGCACCTGATAAATA
TCTTGGAAACATGTTGCTAAGTTACGGACGGACCCTTAGC
ATGTCATTTACAGCCGAGCTGGAGGAGCTGTTGCCCAGAA
GTGTGACTGTGAGGCTGGAGGGCTCTGGGATGTCAGTTTC
TGCTGATTTACACACTCAACAGGAGCCTTATTCACAGCTG
GAAAAGACACCCATTAACTCCTTTTCTCTCAGGTTAACAG
AGAAGCACGTTAATCCATCTGTATCATCATTTGAGTTTCT
CCGCATGCTTTACAATCTGACAGCTCTACATATCAGTAAT
GCAGGAGGCCAGAACTACACATCTCAACTCTCCAGAGTAA
GCCTGGAATCTGCAGTCCAGAAGGCCTATCATCCAGATGT
GCTCCCTCATGCTCTGTGGGTGGAGGTGTGCTCCTGTCCC
GCAGGATTCGCAGGCCAGTTCTGTCAACTCTGTGCTCCCG
GATTCACCAGGGAGACCCCTGATGGTGGACCCTTCTCCCC
TTGTGTACCTTGCAATTGCAATCAGCATGGGACCTGCCAC
CCGGAGACAGGTGTGTGTGCCTGCACAGACTTTACCACCG
GCCGTCATTGTGAACGTTGTGAAGATGGTTACTATGGGAA
CGCACTGACTGGCAGCCCAGGCGACTGCTTACCTTGTCCT
TGTCCAGATCGCACCACCTGCGCCCAGGTGCCAGAGACAG
GGGACGTTATTTGTACCAACTGTCCGACAGGCCAAAGGGG
TGTACGATGTGAATTGTGTGAAGACGGTTTCTATGGCAAC
CCTCTGGGCTGGGGTGGCACAGTGCAACCCTGTGTGAAGT
GCCAGTGTAATGGGAATGTGGATGCCAATGCAGTGGGTGT
GTGTGATCACATGACTGGACGCTGTCTGAAATGTCTGGGC
CATACGACTGGGGACCATTGTGAAAAATGCAGATTGGGTT
ACTACGGCAACGCACTGGCCAACCAACTCAATCCGGAGCG
AAAGTGCAAACCTTGTGCCTGCAACGTGGCTGGGACATCA
GGGTCTCCGAATGACTGCCATCCAAATACAGGAAACTGTG
TTTGCCTGGGTCATGTGACAGGACGAGACTGTGGACAATG
CGAGGCTGGATACTTCAATCTGCAGCCTGGATTGGGCTGT
GAGATGTGTAACTGCAATCCCATTGGCTCATTGTCTTCAG
CATGTCATCCAATCACAGGACAGTGCATGTGTCGAACAGG
TGTCGAAGGGATGTCATGTGACACTTGCCGAATGGGATTC
TTTGGTTTCTCCTCAAGAGGCTGCAGAGCTTGTAATTGTG
ACCCCATGGGCTCGACCTCAATGCAGTGCCACAACAACGG
GACGTGTTCTTGTCGCAACGGGTTTGTTGGTTATAAGTGT
GACAAGTGTGAACAGAACTACTACCAGAACCGCCTGAGCC
ACCAATGCGAGGAGTGTCCTGTGTGCTACAGCATCATTAG
AGACCAGGCCAGTAAACTGAAAGCTAGACTGCAGGAGTTG
GAGTTGCTGCTCAGTAGTTATGACTGCAATAGATACAGCC
GGCAGTATCGTGGGCACCAGCAGCACAGACACCAACATAA
TGACCTGGATAATCACATACAGAAGGACCAGGTTGAAGAC
TACCTGCCCAATGCTCTTGAGGATCTCCTTGCTATTCAAG
AGGCTCGTGAAGCCTTCATAAAGCAGTTCTCACAGCTGGA
AACATCTGCCCAGACCTTACAGCTGCAGCTGCGAAACATT
GCAACAGCCCTGAACTGCAACCTTACCAACTTTGCGAAGC
ATCCAGAGGAAGGAAAGACTCAAAAGGTTGAAAATGAGTG
TCGAGAGCTTGTTGACACTTTATCGACCGCTCTGAATATG
CAGGATCAGCTTCAAAAGATGACTGTTGAACTTAACAGCA
TGGCCATCCCAGCTGTAATCCCTAAAGAACCCAACAAATG
GAATGCCATAGTGAATGAATCTGAGGTTCTGGTGAAAAGT
CACACGGATATGGCGGCTCATATAGAGCAGGTAGCAGAAG
ATGTCTTTAAAATGGCTAACAGAACCTATTTGCAGCTGGT
AACTCTTCTAGAGGACAACTCCACAGAGTCTCACATACAG
GATCTCACAGAGAAGCTGGAGGAGATGCAGCAGCTGAAGG
AGAATCTGACTCTTGAGGTTAATGAGACATTAGTGACACA
CCTGTCACTTCAGAAACACAACGCAGAGATAGCGGACATT
TTACACAACATCACTGCTTCACTGTCAGAACTACGCAGAA
CGGATGGCAATTTCACCCTTGTTGTGGAGGAGACCAACAT
GACCTCTTTCTCACAGACGTTTAATCAAACCAATGTCACA
GCAGCTCAGAATCCTCAACTTACAGAGAGTGAAGACCTGA
TGAACAGAACAACCAATTTAGACATTTCTGTTCAGTCCAA
GGAGCATTTGGTAAATAAGACCAGAGAAGAAATCCAGCCG
GATATGGACAGTGCCAAAAATAACCTGAAAACTGTTCAAG
AGCTGAAGCAGTTGACGGCTGCGGTGGAGGGATTGAAGGT
GTCAGCCGTCTCCTCTGTGGTGACTGGGAAAGAGGTGGAG
GCGGAGATTCTGTCTCTGCAAAAGAGTCTGCAAGACATGG
AGCAGGACTGGCCTCAACTGCCCACGCTCAGCAAAAGCTT
TCTGAAGAGAGAGAAGATGCTGAACGAGAAGACACTGGTG
GAGGTGAAAAAAAGAGTGAAGCAGACAGAGAAGATGATCA
AGCCCTCAGTGGAGAATGCGACAGATGCAGACAGTACAGC
TAAACAGGCCGAGGCGTCGGCAGACACGGTGGCTAAAGAT
GCCAAAGCCTCCTTCACGCAGGGGAAACGGATAAAACATG
CATCTGGACAGTTGCGTTCAGCTCTAGACGTCACCCTGGA
GCAGTTGTCTGAGCTGGAGAGCCAAACCGCACTGAAACAG
GCAACATTGGAAGCAGAGGAGGACATGGTTTCTTCAAGCA
GTGTGATAGACAGCATGGAGACGGCCAAGAATCAGCTGGA
GTCCTTCACAGACATGCTCACTCTGCTTCTCAGTCAAATG
GAAGCTGATGTGGTTCTGGAGAACTACGATCGCATCCTAA
ATGAGACAGCAGTGCGTCTTCGTGTCCTCCAGGGGGCCGT
GGAGAGTCCGTCTCTCACCGGGAAGATCCAGAGGCTTCGC
AACGCCGCGTCTGATCAAGAGAAGCAGATGCAAAATCTTG
AAGAGAGCCTGCAGGACATACGAAAGGAAAGAGACAGTCT
AACAGACATCGCCCAGAACCTGCCCAAAACATGCCCACAA
AAAGGCCACTGAGACAGTGAGA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
lamc3-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000021743 (1),  Ensembl_Trans:ENSDART00000145127 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BI476591 (1) 655 bp
GenBank:GO942479 (1) 610 bp
GenBank:AL925784 (1) 539 bp
GenBank:BI710549 (1) 482 bp
CITATIONS (2)