Community Action Needed: Please respond to the NIH RFI
Transcript

ar-201

ID
ZDB-TSCRIPT-090929-5303
Name
ar-201
Previous Names
  • ar-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000021713 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000021713|OTTDARG00000017972|ZDB-GENE-060131-1 ar|OTTDARP00000018266 CH211-194G1.3-001 LG_none CT025650.6,CR396593.6 Danio rerio protein_coding NOVEL, 3177 bp
TCTGACTGGAACTTTTTCAAGGATTTCGTCGATGAACTTG
TTGCGGTGAGTCCCCTTTAAACCCTCACGGCCTGTGTTGT
ACTCTGCTTTTAGACTATGGAGGTTCCGGTCGGGCTGGTG
GAAGCCTGCGAGTCCCCAGACGCAGTTTTTCACGGACCTT
ACCAAAGCGTTTTTCAAAACGTGCGCGTCGCGAGAGCGAG
CAACCCCGAGAGTTTGGATATTTCTAGCTCCAAGAAGTGC
GGCTGCCTACAGGAGGGCTCGTCGAGGGAAATGCGCTTAA
GTGAGCTGTCCTCATTCAGAAGAATAATATGCTGCCCCGA
AAAAGAGTACGAGAGTGCGAGTTCGGTGATACAGGCGGCG
GCGAGCCGAATTCATTTTCTCAAGAGTTCATCAGGAAGCA
AAAGCGACTCGTCTCTGTCATCTAGCGGCTCGGGCCGCAC
AGACGCCACCGAAAGCAGCGGTAGTCGCGCAGGCTTCCTT
CGGGTCGTCGAGAGTGGACAGAAGGGCTGCGGTGCTGTTG
AAGTTCACACACGAGAGTTGGGCTCGGGCCGTGACGCAAG
TGTGGCGAGTAGTAGTCGTGCGTGCACCACCGCCACCATC
ACCTCCAGCAGCAGCAGCAGCAGCACCACTACCAGCTGCA
CCATATCAGAGACAGCGCGAGAGTTGTGCAAAGCCGTGTC
CGTATCTTTGGGCTTAGCTATGGAGTCCAGCGAACTGGGC
GAGGTGGGACAGCACCATGCACCGCCGCCACCGCCCCTGA
CCACTGAAAGTAGTGAGGAGATCTATTTGTACGGAATGCC
TTTGCTCGACTGCTCAGTGAGCGAACGAGAGGCAGGAAGG
AAAGACCGAGAGTACGCTCTCGCGGCGGGACGAGACAGAG
GCGAAGAGCTCCGAGGCAGGGACAAAGTGCTCGGGATGCT
TAAAAGTGGCGACCTGGAACAGCTAGCTGGTGAGGTGACG
ACCTTGCAGTGCAGCAACGCTTCTCGAGCGAACTTGACCG
CGGATGTGCATGAGTTCGGCAGCCTGTCCGGGGACATTGC
CAACCTGAGTTCAGAAGGTACAGCAGCGCAGACAGCACCG
GATATGGACGGACCGCGAGCGGCTTCGTGCCAGTTTGAAC
AACTGTTGCCCGCGAGCATGACCCATTATGCCCACCCGGA
GCTCGAAAACGGACCGAGCCATAGCTTCGTAAAATCCACA
TCAATGTCTGGAGAGTTTGCTGGTCCCATGGAGGATTACA
CGAATCTCTATAATGTCAGAATCAAGACCGAGATGATGCC
CCGTGATCTGAATGACACCTGGGCGTACCCGCATAGGTAC
GCCGAGGACTCTAACGGCCACTACGGGCCTCCAAAGCAAA
GGACACCTTATGCTACTGGCCACGAACCCCCGTTTATCTG
TAACCCTTATGAATACGGCCGAAGTACTGCTCTGGTTCCG
CGGGAGCGACCTCCGCACGAGCAGTGGTACCCGGGTGGGA
TGCTGACCCGTCATCCGTACCCTAACGTGCCTGGCGTGAA
AAACGAGATGGGCGAATGGATGGATGTAACATCGTTCACG
GATGGCAGGTTTGACGGAGGGAGGAGTGACATTTTCCCAA
TGGAGTTTTTCCTTCCTCCACAAAGGACCTGCCTAATCTG
CTCTGATGAAGCATCTGGGTGTCACTACGGAGCCCTCACT
TGCGGAAGCTGCAAAGTGTTCTTTAAGAGAGCTGCTGAGG
GGAAGCAGAAGTATCTGTGCGCTAGCAGGAATGACTGCAC
CATAGACAAACTGAGGAGGAAGAACTGCCCATCCTGCCGT
CTGAAGAAGTGTTTTGAGGTTGGAATGACCCTGGGAGCCC
GCAAGCTGAGGAAGATTGGACAGATGAAAGGTCCGGATGA
GGTCGGAGCAGTTCAGGGCCCGTCGGAGACTGTCCAGTGC
TTGTCGCCCAAGCCCAACCTGACTTTCCACTCGCAGTTGA
TCTTCCTGAACATTCTGGAGGCCATTGAGCCCGAGGTGGT
GAACGCCGGCCATGATCATGGTCAGCCTGACTCAGCGGCT
GCTCTTCTCACCAGCCTTAACGAGTTAGGAGAGCGGCAAC
TTGTCAAAGTAGTGAAATGGGCCAAAGGACTTCCAGGTTT
CCGTAACTTGCACGTGGATGATCAGATGACAGTCATACAA
CACACCTGGATGGGAGTGATGGTCTTTGCTCTGGGTTGGA
GGTCCTACAAGAACGCCAACGCGCGGATGCTGTACTTCGC
TCCAGACCTGGTCTTCAATGATCGTAGGATGCACGTCTCC
AGCATGTATGAGCACTGTGTTCAGATGAAGCATCTCTCGC
AGGAGTTTGTGCTGCTACAGGTCACACAGGAAGAGTTCCT
CTGTATGAAGGCCCTCCTCCTGTTTAGCGTCATTCCAGTG
GAGGGGCTGAAGAGTCAGAAGTATTTTGATGAGCTGCGTC
TGACGTACATAAACGAGCTTGATCGTTTAATCAACTATGG
CAGGAAGACCAACTGTGCCATGCGCTTCCAGCAGCTGACA
CGACTGATGGACTCACTGCAACCAGTTGTTCAGAAGTTGC
ACCAGTTTACCTTTGATCTCTTTGTCCAAGCCCGGTCTCT
GCCCACGAAGGTCAGCTTTCCCGAAATGATTGCAGAAATA
ATCTCGGTCCAGGTGCCAAAGATGCTCGCCGGCCTGTCTA
AACCAATCCTGTTCCACAAATGACAGGACCACGCCCCCAA
TCTATACCAAGCCCACCCAGGCCATATGAGCCAGTCAGTT
TGGTCTGATCCAGCCTAAACCAGCCTGCGATGCTTTGAAT
CTGGACTCGAATTGAGCGACGAGACTGAACAATACTGATT
TTTTGATTTTTCCATTTTTTAGCATTTCCCTCTCCCTCTC
CCTCTCTCTCTCCCTCCCACCCTTTCTATCTCAGTCTCGT
CTCTCCCTCCTTTTGAAAAATGGCCCTGAAAAGTAGCGGG
ACCATTACATCATTACAGTTGTCTATCTTCTTCTCGGAGA
TGATTTGAGCTCATTTTCTCAAACTGACAGCATGGTGTGA
AGCAGGTTTTGTTCTTTCTTTAGACCAGCAGTTATCCTTC
AAGAGTTACAACGTGTTGCCTGGTGGACAGGTTGGAAAAA
AAAAATATCACACTGAAGTTTCATCTGAGCCCTTAATCAT
AAAAAGAAGAAAAAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations