Transcript

rxfp2l-201

ID
ZDB-TSCRIPT-090929-5300
Name
rxfp2l-201
Previous Names
  • rxfp2l-001
  • si:ch211-124k10.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000021710 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000021710|OTTDARG00000017970|ZDB-GENE-060531-8 rxfp2l|OTTDARP00000018263 CH211-124K10.1-001 LG_none BX005476.5,CU915756.8 Danio rerio protein_coding KNOWN, 2132 bp
CTAGCAGCTTAGGAGAAGCACCCTCACTTGAGTCTCTCAG
AGCATCACGCATCATGCTTCCTCCTCTCTTCCTCTCCTCT
CTTTCCTTTTCCCTTGCTTTTCTCTCAGATTCCTCAGGTT
CTGACATGTGTCCATTGGGTCAGTTTCCATGCGGGAATCT
GTCAGTGTGTTTGCCTCAACCACAGCACTGTAACGGGCAG
CAGGACTGTCCAAATGGAGCAGACGAGGAGAACTGCGTGG
ATAACAGTGGTTGGCCCCATCTATTTGATGCATTCATGAA
AACAAGGGTCCAGGAATCAAAAGAGTGCATGTTAGATGTC
TATCCTGACACGTGTCATTGTGAGGGTCGGAAGGTGAATT
GTAATGGGAAAAACCTGCTCCATGTACCTGCTGTATCCTC
TAATGTGACTGCACTAGAGCTGAACAGTAACAGAATTGAA
TCTCTGTCTCGTGATCTGTTCATCCGCTACAGACACCTGG
AGAGACTACATTTGGAAAGCAACAGTATAGAAACGATCTC
CAAGAGGGCATTTTCAGGACTGGTCGCTTTGCGTAAACTT
TTTTTGAGTCAGAATAAGATTTCGTCTCTGAAAGCAGGCA
TATTTAGTGACCTCAGCAGTCTGGAGTGGCTGATTCTGGA
CGAGAACAGAATATCCTCTCTGCGCCAGAAGTCTTTTGAA
GGCCTGAAATCATTATTTTTCCTGTCTTTATTAAATAATT
CTGTCGAACAGTTTCCTAAAACCTCAATTTGCCATGAAAT
GCCCCGTCTCAACTGGCTGGAAATGGAGGGGAATATAATT
TCATCTCTCTGGGCATCAAGTTTTAAAAACTGCTCCTCTC
TCACCGTGTTAGCGTTGAGGAGAAACCGCATCAGCACCAT
CGAAGAAGGAACTTTTGCAGACATGCAAAGATTGATAGAC
CTAGACGTGTCTGTGAACCAGATTAAAGATCTGCCTCCAT
CTCTGTTCCAGAACCTCCAGAACCTCAAGCAGCTAAATAT
CTCCAACAATCCCCTGGTGAACATATACAGCAATCAATTT
GACAGTTTGGTGAATCTGCAGTCTCTGAGCATGGAAGAGG
TGGAGATTCCCAACATTAGTATCAGGATGTTCCGGCCCCT
TACCAACCTCACTCACATTTATTTCAAGCGTTTTGAATTC
TGTGGATATTCTCCAAATGTGCGGAGCTGCAAACCAAACA
CAGACGGAATCTCATCCTTTGAGAATCTGCTCGCAAACAT
CATTCTGCGGGTGTTTGTCTGGGTTGTCGCCTTCATCATT
TGCTTCGGAAACATCTTCGTCATCTGTCTGCGGTCCTGTA
TTGCTTCAGAGAATCAACATCACACCATGGCCATCAAATC
CCTTTGCTGTGCAGACTGTCTCATGGGTGTATATCTGCTT
TTCATCGGTGCCTTTGACATCAAGTACTGCGGCGAGTACA
ACCGTCATGCTCAGATTTGGATGGAAAGCCTGTCCTGCCA
GCTGATTGGCTCTTTGGCCATGTTGTCTACAGAAGTGTCT
GTCATGATGCTGACCTACATGACACTAGAGAAATACCTGT
GCATCGTCTTCCCGTTCCAGCATTACCGTGCCGGGCGAAA
ACAGACCCTGTGCTCACTGACCTTCATCTGGCTACTAGGA
TTTATCATTGCCGTTATTCCCTTCTGGGATAAACAGACAT
TTGGGAACTTTTATGGGCGGAATGGAGTGTGTTTCCCTCT
TCACTCAGACCAGACGGAGAAACCTGGTGCTAGATGCTAT
TCCACAGCCATTTTTCTCGGTCTGAATCTGCTGGCTTTTG
TGATGATCGTATTTTCTTACTCCAGTATGTTTTACTCAGT
CCAGAAGACAGCAAAGACAGCGCGTCAAACAGTATATGAT
CGGGAAGTGACTATTGCAAAGCGATTTTTTTTCATCGTGT
TCACTGACGCCCTGTGCTGGATCCCCATCTTCCTCTTGAA
AATACTCTCACTGCTAAGAGTACAGATCGCAGGTACTATC
ATTCTGTGGGTGGTGATTTTTATCCTTCCTATAAACAGTG
CCCTGAACCCCATCCTGTACACAATCACAACCAGCGCGTT
TCAGCAGCGACTTAAACAGTGTCTGAAATATCGCTGCCAG
CAGACTAACTGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations