ZFIN ID: ZDB-TSCRIPT-090929-5291
Transcript Name: zmat5-202
Previous Name: zmat5-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000021676 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000021676|OTTDARG00000017947|ZDB-GENE-040808-31 zmat5|OTTDARP00000018240 zmat5-002 LG_ BX004981.4 Danio rerio protein_coding KNOWN, 857 bp
TACCTGTTTTCCTAGACGTTTATCCAACGTATATTGATTT
CTCCTTAATTAAACTGACGACCAGAATACATTTTGAGTTT
GATAAACAATGGGGAAACGGTATTACTGTGACTACTGTGA
CCGCAGCTTTCAGGACAACCTCCACAACAGAAAGAAGCAC
CTAAACGGCGTCCAGCATCACCGGGCGAAGAAAGCCTGGT
TTGACAACTTCAGAGATGCTGCCACACTTTTAAACGACGA
GCGATCGAAAGAAGTCTGTAGAAAGTTTGTCCAGACAGGA
CATTGTGTGTTTGGTACGAGTTGTCGATTTTCACACATGT
CTGAGAAGCAAATGAAGATGCTGGAGCAGAAGATTGATGA
ACTTTGTGGTGACTTCCTGCCAGATGAAAAGCGTCAGAAG
GAAGATCCTGACCAGGATGGATCATCTGAGCGCAGCGTTG
ATGAATGGCTCTCCAGAAGAGAGAAGAAACTGGCTGCTTT
GACATCAGGAAGAGTTTTAAGGATGGAAGAGGAAGAATGC
ACAGAAAACATTGAGATACCTCCTTATTTGCTATCTATTC
CAGATCTTCCTCCATCTCTCCATCCTCCACCTGCTGGTGG
TTGGAGAGTGACGGTGCACAACGAATGGGGTTGAAATTAA
ATGTAAAATCCTTTTATTTAATGATTTTTTTCCTTTTAGA
CCATGCTGCTCACTGTAATCTTTACAAAGGCTTTTTATAT
ATCAAAAACATTGTACATATTTCTATCCAAACAATTGCAT
GCATAATATATTTGTGTAATAGGAAGCATGTCTGCATGAC
TGAACAAGTTTACATTTTATATAAACACTCTCAATAAATA
CAGTGCATTTAACTTCA

zmat5 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA zmat5-201 (1)    Ensembl 860
zmat5-202 857
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
zmat5-202 Contained in:
[BAC] CH211-169J7 (1)

Genome Resources: Vega_Trans:OTTDART00000021676 (1),  Ensembl_Trans:ENSDART00000144510 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:DT872319 (1) 734 nt
CITATIONS (2)