ZFIN ID: ZDB-TSCRIPT-090929-5290
Transcript Name: zmat5-201
Previous Name: zmat5-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000021675 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000021675|OTTDARG00000017947|ZDB-GENE-040808-31 zmat5|OTTDARP00000018239 zmat5-001 LG_ BX004981.4 Danio rerio protein_coding KNOWN, 860 bp
ATATTGATCTAGCAAACAGAAGGAACGTACCTGTTTTCCT
AGACGTTTATCCAACGTATATTGATTTCTCCTTAATTAAA
CTGACGACCAGAATACATTTTGAGTTTGATAAACAATGGG
GAAACGGTATTACTGTGACTACTGTGACCGCAGCTTTCAG
GACAACCTCCACAACAGAAAGAAGCACCTAAACGGCGTCC
AGCATCACCGGGCGAAGAAAGCCTGGTTTGACAACTTCAG
AGATGCTGCCACACTTTTAAACGACGAGCGATCGAAAGAA
GTCTGTAGAAAGTTTGTCCAGACAGGACATTGTGTGTTTG
GTACGAGTTGTCGATTTTCACACATGTCTGAGAAGCAAAT
GAAGATGCTGGAGCAGAAGATTGATGATGAAAAGCGTCAG
AAGGAAGATCCTGACCAGGATGGATCATCTGAGCGCAGCG
TTGATGAATGGCTCTCCAGAAGAGAGAAGAAACTGGCTGC
TTTGACATCAGGAAGAGTTTTAAGGATGGAAGAGGAAGAA
TGCACAGAAAACATTGAGATACCTCCTTATTTGCTATCTA
TTCCAGATCTTCCTCCATCTCTCCATCCTCCACCTGCTGG
TGGTTGGAGAGTGACGGTGCACAACGAATGGGGTTGAAAT
TAAATGTAAAATCCTTTTATTTAATGATTTTTTTCCTTTT
AGACCATGCTGCTCACTGTAATCTTTACAAAGGCTTTTTA
TATATCAAAAACATTGTACATATTTCTATCCAAACAATTG
CATGCATAATATATTTGTGTAATAGGAAGCATGTCTGCAT
GACTGAACAAGTTTACATTTTATATAAACACTCTCAATAA
ATACAGTGCATTTAACTTCA

zmat5 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA zmat5-201 860
zmat5-202 (1)    Ensembl 857
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
zmat5-201 Contained in:
[BAC] CH211-169J7 (1)

Genome Resources: Vega_Trans:OTTDART00000021675 (1),  Ensembl_Trans:ENSDART00000051357 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC079486 (1) 900 nt
GenBank:CK687924 (1) 760 nt
GenBank:BM140956 (1) 631 nt
GenBank:DN898398 (1) 585 nt
CITATIONS (2)