Transcript

si:dkeyp-15f12.4-004

ID
ZDB-TSCRIPT-090929-5286
Name
si:dkeyp-15f12.4-004
Previous Names
None
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000021671 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000021671|OTTDARG00000017944|ZDB-GENE-060526-367 si:dkeyp-15f12.4|no_translation DKEYP-15F12.4-004 LG_ BX004981.4 Danio rerio processed_transcript NOVEL, 611 bp
TACGTTTGTAGTTATATTGCCTGCAATATTCAGTTTTTTC
ATTATTCACTTACCAACTATAGGATTCAAGTACCTCTGTG
GTGCGGAAGAGAGACGTGGCTCTGAGATGCCTCATTGAAT
ACATGGGAGAGAGTGGGCAAAAGCTGATCTCTGACTACTA
TATGTGGTGGGCATCATCATTGAGGGCATCCCTGTGCTTA
CTCGTCTTGGAAACCACGCCAGGGCTATGAACTTGCAGTA
TCCACCACAACTCAGCAAAACATTTCAGGTGTTTCAAAGA
CATTTTGTGGGACTTGACACACTGCGTCCAAAGTCTTCCT
CCTGATTCATGACACAAAAACTTCTGAGTTAGTTAATTAG
TTGCCGCTCAGAGGTTCTGTTTCTTTGCTTCATCACTATT
GTTCAATGGACAGTTTGACTTGGAACAATGTGGTAGTCAC
GCACCGACTTCTTCAGTTTCTGGATAGGTCTGCAGCAAAT
ATGGGCATTTGATTTGCTTTTGTATATATGGGGCAAAGTT
TGTTTTGTTTTGTCAAATGCTGAGATCAGAGGCACTTTAT
TTTTTTTATTTCAATGTTGTAGTACATATGAAAATGTACT
GTACTGTGCAC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations