ZFIN ID: ZDB-TSCRIPT-090929-5284
Transcript Name: si:dkeyp-15f12.4-002
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000021669 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000021669|OTTDARG00000017944|ZDB-GENE-060526-367 si:dkeyp-15f12.4|no_translation DKEYP-15F12.4-002 LG_ BX004981.4 Danio rerio processed_transcript NOVEL, 662 bp
TTTTTTAGAGAGATGTCAGAAGCATAAATGACATGATGGC
TAGGACATATAGCTGGGGGAGAATGGAAGTGGTTGTCCAG
AGCCCAGATGTGCAAAAATTAAAGAAAGATGGCCTGCCCA
GGATTCAAGTACCTCTGTGGTGCGGAAGAGAGACGTGGCT
CTGAGATGCCTCATTGAATACATGGGAGAGAGTGGGCAAA
AGCTGATCTCTGACTACTATGGAAAAACAGAGAACAGTGT
CTATGAAGACTTGAAAATGCGCAATATGCAGATATATGTC
TGCCGTGTTCCAGATGTGGTGGGCATCATCATTGAGGGCA
TCCCTGTGCTTACTCGTCTTGGAAACCACGCCAGGGCTAT
GAACTTGCAGTATCCACCACAACTCAGCAAAACATTTCAG
GTGTTTCAAAGACATTTTGTGGGACTTGACACACTGCGTC
CAAAGTCTTCCTCCTGATTCATGACACAAAAACTTCTGAG
TTAGTTAATTAGTTGCCGCTCAGAGGTTCTGTTTCTTTGC
TTCATCACTATTGTTCAATGGACAGTTTGACTTGGAACAA
TGTGGTAGTCACGCACCGACTTCTTCAGTTTCTGGATAGG
TCTGCAGCAAATATGGGCATTTGATTTGCTTTTGTATATA
TGGGGCAAAGTTTGTTTTGTTT

si:dkeyp-15f12.4 TRANSCRIPTS
Type Name Length (nt) Analysis
ncRNA si:dkeyp-15f12.4-001 (1)    Ensembl 825
si:dkeyp-15f12.4-002 662
si:dkeyp-15f12.4-003 (1)    Ensembl 772
si:dkeyp-15f12.4-004 (1)    Ensembl 611
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkeyp-15f12.4-002 Contained in:
[BAC] CH211-169J7 (1)

Genome Resources: Vega_Trans:OTTDART00000021669 (1),  Ensembl_Trans:ENSDART00000133852 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:DV593814 (1) 779 nt
CITATIONS (2)