Transcript

tmem2-002

ID
ZDB-TSCRIPT-090929-5178
Name
tmem2-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000021509 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000021509|OTTDARG00000017836|ZDB-GENE-030131-2179 tmem2|no_translation DKEY-24K20.1-002 LG_ BX294191.4 Danio rerio protein_coding NOVEL, 286 bp
TACAGTGTGTTTTCTATTTAAATGTGTGCAGTTTGTTTGA
TAACTTATTTCAGTTCATGTTTATTTTATCTTACAAAAAT
GGGTTTAGCTTGTAATTAGTTTTTCAAAATTACTGTATAA
TAACCTTAAGTGGCTGAATTTCTGTTTAGGTCAATAGTTC
TACTTGCCACAAGAGGTCAGCCTGCTAGCTTTGCTGGTGT
CGCACAATATCTGGAGTCTTTGGGATCTGCTAAAACACCA
GACCTTCAGAATAAAGTCGCCATTGCTTTTTTCGGGTTCC
TCGGTC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations