Transcript

cemip2-202

ID
ZDB-TSCRIPT-090929-5177
Name
cemip2-202
Previous Names
  • tmem2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000021508 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000021508|OTTDARG00000017836|ZDB-GENE-030131-2179 tmem2|OTTDARP00000018106 DKEY-24K20.1-001 LG_ BX294191.4 Danio rerio protein_coding NOVEL, 5343 bp
ATGCAGGTGAATGATGGCCCCAGCAGTCACCCCATTTTTG
TGGCTCCTGTCAATGGCAATGCTCAGCGGTCGTCAGGATA
TGTTCCAGGCAGGATCGTTCCAGTTCGTTCTCCACCCCCA
GCCAAAGCTCCTCCACCGCCCCCATTGAAGCCCCCCGTCC
CGCCGCCTGCACGGCCTTCAGTGTTTAATCTGTCTGAAGA
TGGGAACAGAAGGGAACAAGCCCAGAACCAGCAAAGGAAG
AACACTTACATCTGTGTCGGCATCTTCTTTGGCATTTTCC
TACTGATTCTCATACTCGTCCTCAGCCTTACCTCTAAAGA
TGTTTTGGATGAAAACTGCCCTCATCAAAACCCTGCTCTG
CGATCCTGGAAGCCGGGTCACGATCTCAAAAAGGTGGTGG
TGATACACAGCGGTGAACATTATCGCCTAGATTCATCTGC
CACCTTGTATTCAATCACGATCCAGGCTGGAGGTTCTGTA
GTCTTCGCGGATGATAAAAAAGGGTCTAAAAACATCACGT
TACGAACACGGCACATTTTAATCGAAGATGGCGGCGCTCT
CCATATTGGGGCTCCAAAATGTCGATATCGCTCTCTGGCT
ACTATCACCCTTGTTGGCCGATCAGATGAGACCGCCGTGA
CTGAGGTTCCAGGGATGGGCCGCAAGTTTTTAGGTGTGAA
TTCTGGAGGAACTCTGGAGCTTCATGGGTCAGAAAGGATG
TCTTGGACCTTCCTCACTCGCACCGTGCCTGCTTCAGGAT
TGGCTACGGGTGACCACGCCTTTCAGAAAAACTTCAGCCG
TGGAATTAACCTCCGTGTGGTTGATCAGGACACGGCAGAG
GTTCTGGTTAATGAGCGCTTCGACACGCATGAATCTCAAG
ATGACAGTAAAAGGCTGGGTGAGCTGCTGAAGGCTCTGCC
CGCAGGACGCATCGTTGCACTGGCCACTGGAGATTCTGCG
GTGAAGAACCTGGTGTTTGAGACCAAACAAACCATCCACG
ATCTTCTAGGGAGCAACTATATCAGTGATCTCAAATACAG
GGATGCCTGGGCCTTGGTCTCTGTGATTGGGGGAGGCAAT
GGTTCATGCACAGAAGACGTTCGAGAGCATGAGAACCATG
ACACAGGTGGCAAGGCGCTGGCTCGCCAAGACTTCTTCAC
TGTGGATGGTGTCGGTTTCACTGTTACTGCTTACAGTGAA
TGGAGTAATGGTTACCCTACTACAGGCTTCCAAGTGGATG
CAGTGGATAAAGTAGTTCTGAACCTGCAAGATGACGTGAG
CAGCTGGAATCCGGGTGATCGGATTGTGGTGGCTAGCACA
GATTACTCCATGTACCAGGCAGAAGAGTTCACCCTGCTCC
CCTGTCCAAACTGTAACAGAAAGCAAGTTCAAATTCAAGG
AAAACCTCAGTTCAGCCATGTTGGCGAGATCCTGGACGGC
GTAGACATGCGTGCGGAGGTCGCTCTCCTCTCAAGGAATA
TCCTCATTCATGGAGAGATGGAAAATTCCTGCTATGGAGG
AAACTGGTGCCAGTACTTCAGCTACGACACCTTCGGGGGA
CACATCAAGATTTTGGGGAACTTCACGTCAGTACATCTGT
CTCACATAGAGCTGAAACACATGGGTCAGCAGCGTGAGAA
GGGCAGATACCCTTTAAACTTTCATAGATGTGGAGATGTG
GACCAGAGTGGAGGATACAGTAACCCTGCATATGTGGACT
CGCTCTCCATCCATCACTCCTTCTCTAGATGCGTTACTGT
ACACGCCACAAATGGCCTGCTGGTTAAGGACACTGTTGGC
TATGATACACTGGGACACTGTTTTTTCCTGAAGGATGGAA
TTGAACAAAGGAACATATTTTTCCATAACCTAGGCTTGTT
GACCAGACCAGGAACCATTCTACCTACTGACCGCAACGAC
AGCATGTGCACTGAAATCACAGATAGGGTATACAAAGGAT
ACATACCAATTCCTGCGAATGAGTGCAAGGCAGTGTCTTC
ATTTTGGATCGCCCACCCCAATAATCATTTGATCAGTAAC
TCAGCAGCTGGATCTCAGGATGCAGGGATCTGGTATGTTT
TCCACAACTCGTCTACAGGTGACTCTCACGGAATGATTTC
AGAAACGAAAGCTGAGCTCACGCCTCTGGGCACCTTCTTT
AACAACCGTGTTCATTCCAACTTTAAGGCTGGCCTCTTTA
TTGATAGAAAAGTCAAGAGCACCAATGCCACTGCAGCAGA
CCCACGTGAATATCTCTGTCTGGACAACAGTGCTAGGTTC
AGGCCTCACGAGAGCTCTGATCCTAGCAGGCCACGGGTGG
CTGCAATCATTGATACTCTCATCTCCTTTAAAAATAATGA
TCTGGGTGCCTGGATTCGTGGAGGTGACATCATCATACGA
AACTCAGGTGATGGCAGTTACCCGAAAGATGAAGGCTCCA
GTCAGGAGGTCTCCCAGTCTCTGTTCATTGGTGAGAGCAG
AAATCGTGGCACCAATGGAGGTCAAAACAAATACTGGGGT
ATTGGTGGAGTTGACGGAAAGATGAGGACTCTTCCTAGAA
ACAAGACGTTTCCCATCCGAGGTTTTCAGATAAATGATGG
TCCAGTGAGGATCTTTGACAGCACGTTTCGGGCCTTCAGT
CCCACAGCAGACCGCTTCACTATGGCTGTGGGATTCAGTC
TGAAAAACATCTGGCAGCTGACACCCAGAAATAACCTGTC
TGCTCTCGCCTTCCATCCTAGTGTCACTCTAAGAGCATTT
TTTGGCCGACCAGGCGATTGGTTTGAGCAGAATGATCTGG
ACGGTGATAAAAATTCAATTTTTCATGATCTCGATGGATC
TATCAGTGGTTATGCAGATACGTATGTGGCAAGAGCTGAC
AACTTCCTGATCCGCCACCCTCAGTGTGTAGACATGCCTC
AGTGGAATGGAGTTGTTTGCAGTGGAAAATACTCTCAGGT
GTACATACAGACGCAGGCCGCATCTAATCTGAGCCTGTCC
ATCAGTAGAGACGAATACCCTGATAAACCAATGGTTCTCA
GAGGCATCAGAACCAAGACATCTCCATCTCAGCAGTACCA
GCCTGTGCTGATGATGGGCAAGAGCTACACCATGCACTGG
AATGGACCTGCACCTAGGGAAACTGTCCTGTCACTCATTA
ATTTTGACCAGGATGATTGGGCTCTTCTCGGCCTCTGCTA
CCCCAATGAAACAGTCTTCCAGATCACCTCAGACATCTAC
AACAAGCAGAACAATGGCTTCGAAGGGATAGAAGACTACG
GCCCTGTGACGTCTATTGCAGACCTAGAGAAACGACAGCA
GGAGAGGAAGTACTTCTTCGACAAATCTGCAGGTCTGTTA
TGGCTGTATGCAAGAGCTCGCCACAGACGAGACGGCAACA
GCTACTGCTCCTCCGCCGGCTGCGAAAGAGTCAAGATCAT
CGCCACCATACGTGCCAACCAAAAGACTGAGACCTGCAAC
TGCACCGCCAATGCCTACCCCAAATACAGCAAGCCTGCCA
GCAACATAGTGCCTATGCCAAAGCCCAACACGGAGCCCTG
CGGAGCCTGTGGGGCCTCACAGTTTGCCTTCTCCAGTGAT
CCATGGAACAGCTACCTCCAAACGCAAATCAAATCCCTGA
GTGTGAAAGAAGAGCAGGATAATGACACGCAAGCCTATAT
TACTGTGAATGCACAGAGATTTGACCTTAGCCAGTCTGGG
TTTCTTCTAGTGACTGTGGATGCTTGCTCTGGAAAAGTCA
CAAAGAACTCAATGTTTTCATCGCTGGACACTAAAATGGA
ACAGTTTTTTAAAACTGGAATTATGAAGAGGTCAATAGTT
CTACTTGCCACAAGAGGTCAGCCTGCTAGCTTTGCTGGTG
TCGCACAATATCTGGAGTCTTTGGGATCTGCTAAAACACC
AGACCTTCAGAATAAAGTCGCCATTGCTTTTTTCGGGTTC
CTCGGTCAGGGAGGTCCTTCACCTCAGCCATGGTCTACTC
TGTTGACCTGCCAAGGTGCCAAGATTTTGGGATTACAGGA
ACGGTTCATTCCCCTGTCCCTCGAGGAATACTCTTGTCCA
CCAAAAAAAGACTCTCCCACACGGATGGATCTTGAACTCC
TGAAAAAAATCTCTTAGCCAAAAGTGAGCCTTTACTAGAT
GTGAATCAACAACACAACCAGCAAATGAATGTGAACTCAT
GAACGTAATTTATTTTGGCAAACTAGTGTTAATGGACTTA
AGTATTTGTTATGTGAGTGGATGTATTTGTCTTCTTTGTT
TGTCATTTTGTCTTGCGTGATTGTGGTTTGTTGTAAATGT
TATTGTACAGCACAAAGTGATGCACTTTTTAAATACATGC
CAAACTTTTTTTTTTTAAACTGGATAACAAATGGACAGCA
CAAGCTAGAAGTACATCACAAATTCTGAAGTTCGATGGCT
TCTTTTTCTCCTCAAACAATCTGCAGGTTTAATTGACACT
CAGATTTTTTTCTCAGTTATTTATTCCTTTTGTATCAGTG
GGACATGCCATTATTTAATTGTGTCATTCTGCTTCTCATG
CAGCAGTTAATCTGCAGTATTTACAGTACTTTCAAAGTTG
ACTATTAAACTGTATTAATGTTTCATTTAACATAAAAAAA
TAAATGCAGGTAAATTATTTTCTCATATAACATTAAACCA
TTTTCGCTTGTTAGGTATGTGTATGTGGAAAAGACTAAAC
AGATCAGGTCACTTGAAATCACACCAAATATTTGTGTATG
CCATAGTTCAACTGATCATTCTGCCTCATGCTTATTTGCT
GTCATGTTGTTCCAAAACATTTGTTTTTTACTAAGTGGAA
CATAAGACAAATAATAAAGTACCATTTACTGTTATTGTAG
GGAAAAACAATGAAAGTGAATTCCAGGATGTTAGTTTAGT
ATTTATCTCAAAACCAATTATTATTGTCAAATTTAACTGT
AACTACACAAGAGTACGTCAATTGTAATTTTTCAGTTCCT
TTATTAAAATGCCAGATGTCTGCCTTTGAAGTGGCATCAC
TCGCTTAGCTTGATAAATCTATCATCCCATGGAAAATACA
TTTGTCATTTTGTGATTGAAATGAAAGCCTGAATGTGACG
TTTTTGAGTTAGTTAGGCTATTTTTTAACCACTGAGGTTT
TTATTGATAGACTGAAATGTTGCATTTTTTATAGATGCAA
ACCCCCCGTAAATGTATGTTGTTTACATCACAAATGTTGT
TATTATTGTCAAATGCTCCCTTTCTTTCTCTTTTAACTGG
CTTTGCTTTTGTGCTGTAATTTGATGTGAACTTCCGTTAA
GATATAAATTTTATAAAACATGT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations