header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-5073
Transcript Name: ascl1a-201
Previous Name: ascl1a-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000021382 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000021382|OTTDARG00000017747|ZDB-GENE-980526-90 ascl1a|OTTDARP00000018012 ascl1a-001 LG_ BX510924.11 Danio rerio protein_coding KNOWN, 1977 bp
CCAACTCAGAACAGGTCGAGAGTCCGGAGCACCCCTGCCC
ATTGAAGCCACACGTGAACGCCACGAGCAAGACGCACGGC
CACTGGGCAGTCCAAAGAAAACTTTAGTGCTTTGACTCAC
TCCTTTTTTTGACTCCGCGAAATGGACATCACCGCCAAGA
TGGAAATAAGCGTAAACCAGCAGCAGTTCATGCCACCTGC
TTGCTTTTTCGCCTCTCAGAGCATCCAACTCAGCCCGACA
GACAGCCAGTGCAGCAACAAGTCCGCGTCAAAGCAGGCAA
AGAGGCAGCGCTCATCCTCCCCGGAGCTGCTCCGGTGCAA
AAGAAGACTCAATTTCGCCGGTTTCGGCTACAGCTTACCC
CAGCAGCAGCCGCATGCGGTGGCCAGACGGAACGAGAGAG
AACGCAACCGGGTGAAGCTTGTGAACAACGGCTTTGCAAC
CCTCCGCGAACACGTTCCCAATGGAGCGGCCAACAAGAAG
ATGAGCAAAGTGGAGACGCTGCGCTCGGCTGTGGAGTACA
TCCGCGCGCTGCAGCAGCTTCTGGACGAGCATGACGCTGT
AAGCGCGGCATTCCAGTCGGGCGTCCTGTCACCCACCATC
TCCCAAAACTACTCTAATGACATGAACTCTATGGCCGGTT
CGCCTGTATCCTCATACTCATCGGATGAGGGCTCATACGA
CCCTCTGAGTCCAGAAGAACAAGAGCTCCTGGACTTCACC
AACTGGTTTTGAGCGTTCGTAAAAGGAAACTTAAAAATAT
CAGCACTCGCTTGGGAGGATGTCCTCCAAGAACACAAAGC
ACTGCGTTTGCGCTGCAGTCCGGTTCGGATGCACACCCAG
AGATGGCCCATACAAACCGGCAAACCACGGGTCCCGAGTG
TCAAAGAGCCAAGGGACTAAGAGGGAAGAGCGGGAATCCA
GTCCTTCCAGCGCACTCGCCCAAGAAATCTATTTTAAAAA
GACTTTCCACGACACCGTGGCATGCATACAAAAACAACAA
CAAGCAAACGTTGTTCTTTACCTATGCTAATGTAATCAAA
GAAGGTTTGCCCTGATAGACCCCTCTCTCAAAACTCTGAT
ATGCTTCCAACTTGGCGAATTTTATTATATGAAGTTCTAT
TTGTATAAAACATGTTGTTTTTGGAAATATATTAAGCTAT
TTTTGTATGTGAGAGATTTATAGATGTTTTTGTACACATT
CATTTTAATATGTATATTTTGACCTATAGCCTGCCGTAAA
TTGCTCATTACCTCTTGCTTATTCAGACTTATAGTCTCAA
ATGCATCGCAGCTGGCAATTCCCTTTACGGTTGTGGAGCT
TTTAGAGGAGTGTAATGCTCAAGAGTTTAAATTTCAGCAC
CAACGTGTCTTATTTAATAGGAATAATAATTGCAATTGTA
ATGTGACTCAGAGTGATCAAAGGTTATGCAGCTATTGTCC
AAACGGAGGTGTTTTGTGTCTCCACACTGCCTGTTCCACT
TTGCCTTTACAATGCTGGGTTTTGCCTCCCTCAGAAAATA
AGAATATGCCTTATCTCCATATTTTCTACAGTTTAGTCTC
ATAATAAAACGTTTCTAAAAAGAAATATGCTTTCTTGGTT
TTTGCTTTACGTGTTGCAGTCAATTATTTTGCTTTATGGT
GGTAGAACACAGTCATGTGTCAAAGATTTTTGTTCATTAC
ACATTTTCTTTTTATATAGACAACAAAAGTGATAAGCCAT
CCTGCTAACCCTCGGCAGTCTGCCTGTTGTCAGGCAGGGG
AGACGTGACCAGCATGCTGGACCGTTTCAAAGACTGCGCT
CTTAATGAATGCCAATTTGGAGACAGCACTTTTGGAAAAT
AAGCAAATTGTATGCTCATTCCATACACGTTTTGTGGGAA
AAACGTTATTTATTTGTTTATTTATTTGTGCAATAAGTGG
TGGAATCTCTGAACAATCACACAATTTTGACGTTTCTAAC
GTTAAAAAATATCTAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ascl1a-201 Contained in:

OTHER ascl1a-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000021382 (1)
  • Ensembl_Trans:ENSDART00000056005 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC098521 (1) 1596 bp
    GenBank:CN505049 (1) 946 bp
    GenBank:DT880561 (1) 776 bp
    GenBank:AL726259 (1) 738 bp
    GenBank:AL726347 (1) 669 bp
    GenBank:CR931369 (1) 539 bp
    GenBank:AL720547 (1) 538 bp
    CITATIONS (2)