Transcript

ascl1a-201

ID
ZDB-TSCRIPT-090929-5073
Name
ascl1a-201
Previous Names
  • ascl1a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000021382 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000021382|OTTDARG00000017747|ZDB-GENE-980526-90 ascl1a|OTTDARP00000018012 ascl1a-001 LG_ BX510924.11 Danio rerio protein_coding KNOWN, 1977 bp
CCAACTCAGAACAGGTCGAGAGTCCGGAGCACCCCTGCCC
ATTGAAGCCACACGTGAACGCCACGAGCAAGACGCACGGC
CACTGGGCAGTCCAAAGAAAACTTTAGTGCTTTGACTCAC
TCCTTTTTTTGACTCCGCGAAATGGACATCACCGCCAAGA
TGGAAATAAGCGTAAACCAGCAGCAGTTCATGCCACCTGC
TTGCTTTTTCGCCTCTCAGAGCATCCAACTCAGCCCGACA
GACAGCCAGTGCAGCAACAAGTCCGCGTCAAAGCAGGCAA
AGAGGCAGCGCTCATCCTCCCCGGAGCTGCTCCGGTGCAA
AAGAAGACTCAATTTCGCCGGTTTCGGCTACAGCTTACCC
CAGCAGCAGCCGCATGCGGTGGCCAGACGGAACGAGAGAG
AACGCAACCGGGTGAAGCTTGTGAACAACGGCTTTGCAAC
CCTCCGCGAACACGTTCCCAATGGAGCGGCCAACAAGAAG
ATGAGCAAAGTGGAGACGCTGCGCTCGGCTGTGGAGTACA
TCCGCGCGCTGCAGCAGCTTCTGGACGAGCATGACGCTGT
AAGCGCGGCATTCCAGTCGGGCGTCCTGTCACCCACCATC
TCCCAAAACTACTCTAATGACATGAACTCTATGGCCGGTT
CGCCTGTATCCTCATACTCATCGGATGAGGGCTCATACGA
CCCTCTGAGTCCAGAAGAACAAGAGCTCCTGGACTTCACC
AACTGGTTTTGAGCGTTCGTAAAAGGAAACTTAAAAATAT
CAGCACTCGCTTGGGAGGATGTCCTCCAAGAACACAAAGC
ACTGCGTTTGCGCTGCAGTCCGGTTCGGATGCACACCCAG
AGATGGCCCATACAAACCGGCAAACCACGGGTCCCGAGTG
TCAAAGAGCCAAGGGACTAAGAGGGAAGAGCGGGAATCCA
GTCCTTCCAGCGCACTCGCCCAAGAAATCTATTTTAAAAA
GACTTTCCACGACACCGTGGCATGCATACAAAAACAACAA
CAAGCAAACGTTGTTCTTTACCTATGCTAATGTAATCAAA
GAAGGTTTGCCCTGATAGACCCCTCTCTCAAAACTCTGAT
ATGCTTCCAACTTGGCGAATTTTATTATATGAAGTTCTAT
TTGTATAAAACATGTTGTTTTTGGAAATATATTAAGCTAT
TTTTGTATGTGAGAGATTTATAGATGTTTTTGTACACATT
CATTTTAATATGTATATTTTGACCTATAGCCTGCCGTAAA
TTGCTCATTACCTCTTGCTTATTCAGACTTATAGTCTCAA
ATGCATCGCAGCTGGCAATTCCCTTTACGGTTGTGGAGCT
TTTAGAGGAGTGTAATGCTCAAGAGTTTAAATTTCAGCAC
CAACGTGTCTTATTTAATAGGAATAATAATTGCAATTGTA
ATGTGACTCAGAGTGATCAAAGGTTATGCAGCTATTGTCC
AAACGGAGGTGTTTTGTGTCTCCACACTGCCTGTTCCACT
TTGCCTTTACAATGCTGGGTTTTGCCTCCCTCAGAAAATA
AGAATATGCCTTATCTCCATATTTTCTACAGTTTAGTCTC
ATAATAAAACGTTTCTAAAAAGAAATATGCTTTCTTGGTT
TTTGCTTTACGTGTTGCAGTCAATTATTTTGCTTTATGGT
GGTAGAACACAGTCATGTGTCAAAGATTTTTGTTCATTAC
ACATTTTCTTTTTATATAGACAACAAAAGTGATAAGCCAT
CCTGCTAACCCTCGGCAGTCTGCCTGTTGTCAGGCAGGGG
AGACGTGACCAGCATGCTGGACCGTTTCAAAGACTGCGCT
CTTAATGAATGCCAATTTGGAGACAGCACTTTTGGAAAAT
AAGCAAATTGTATGCTCATTCCATACACGTTTTGTGGGAA
AAACGTTATTTATTTGTTTATTTATTTGTGCAATAAGTGG
TGGAATCTCTGAACAATCACACAATTTTGACGTTTCTAAC
GTTAAAAAATATCTAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations