ZFIN ID: ZDB-TSCRIPT-090929-5018
Transcript Name: zgc:77650-201
Previous Name: zgc:77650-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000021123 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000021123|OTTDARG00000017490|ZDB-GENE-030131-6151 zgc:77650|OTTDARP00000017771 DKEYP-1H4.11-001 LG_ CR318588.10 Danio rerio protein_coding KNOWN, 1622 bp
CACTAGACGAGCATCACACAGACAAAACTTTAGACATTAG
GAGAAACCTCGTAGTTTTAGGTGATTAGTGTGCTTCGCCA
TGGGTCTGACCATCTCGTCGCTCTTTAGCAGGCTGTTTGG
AAAGAAACAGATGAGAATTCTCATGGTGGGTCTGGATGCT
GCAGGGAAAACCACAATATTGTACAAACTGAAACTTGGCG
AAATCGTGACCACAATTCCAACAATAGGTTTTAATGTAGA
GACTGTTGAATACAAGAACATCTGCTTCACTGTGTGGGAC
GTCGGCGGTCAGGACAAGATTCGTCCCCTGTGGAGACACT
ATTTTCAGAACACACAGGGTTTAATCTTTGTAGTGGACAG
CAATGACAGAGAGAGAGTAGCAGAATCTGCAGAGGAGCTT
TCTAAAATGTTGCAGGAAGATGAACTGAGGGACGCCGTGC
TTCTGGTTTTTGCAAACAAACAGGATCTGCCTAACGCCAT
GGCTGTCAGTGAACTCACAGACAAACTCGGCCTGCAGAGC
CTACGCAGCAGAACGTGGTATGTTCAAGCAACCTGCGCAA
CACAGGGCACTGGACTCTATGAAGGACTGGACTGGTTATC
AAATGAGCTCTCCAAACGCTAGTGTGTGCCTTTTAGGGTC
CTAGATGGTGCGTATAAACCAATGGAAAAGCTAGAGACTC
CTCTTAGAATTGAATTAAGTGTGTGTGTGTGTGTGGCACA
GCGGGAAGCTGGAGAAAAACCATCAAAAACTCTGCGCTCT
TTTCTACAACACACTCTTTTGCCCACGTTTATCTGTTTTT
TTTTATTTTATTTCGTTCAGACAAAAACAGCTTTTTAAAA
AATAATTTTGCTGCATTTTCAGTTTTTCAGGAGGGCGTCA
AGCAAAACCAGAAACACTGGAGTGTTTGATCAGTGAGTTA
TTGGTTTTGCTATTGGATTGTTTTGCTGGAAATTTGTGTT
AAGGAGATTGTCGTTAAGCTCACTGGAGGTCAGTAATATT
TCATTCACAACATGTGGAGTCGACTGGCGAATCAAAGCCA
TTCATTTCCATCAATCCTACTAGATATGCAATGTTGTAAA
GTCTGTTACGTTGCGTTATCCGCTGTAGAGTCTCGTGGTC
CTTCTAAACATTATCTGCATGAGTTAACTTCATTCTGGAT
CTCAGTTTCCAACATCAGCAGCACATGGCATGAATGGCAT
GAAAAGGTTCACTTTCTTTTTATAGGTTTGCTTCCCTCTC
AATCCGTTGTGGTTTGTGGCAAATGTTTGAGTGACCCAGA
ACACAGGTTTTAATGTAGGAAGGGGTCAAAGGGAACGGGA
TGTCCTTTAGCCACGGCGACGCAATGAAATTCTTTTCATT
TATGATTTAAAGTTACAATTGACGTGTTTTATGTCCAAAA
CGTTCCGCTCGGGCGAGTTTCTTGAGCTTATCATTATTGG
TGATTGAATGTGACTTCTGAATGCAGACTTAACGTCATCG
ATGAATTCCATGTCTGGTTGAAATGGTTTGCTTTCTTAAA
CTTATGTGTAACAGATACAATCTATTTTACCCTAATATCA
TTATAAATTTGTTTGTGTATTATATGTATGATATTGTTTT
AGAATAAAAGATAATCATGACC

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
zgc:77650-201 Contained in:
[BAC] DKEYP-1H4 (1)

Genome Resources: Vega_Trans:OTTDART00000021123 (1),  Ensembl_Trans:ENSDART00000062143 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC062831 (1) 1646 nt
GenBank:CN018446 (1) 901 nt
GenBank:CK697080 (1) 896 nt
GenBank:CK238042 (1) 807 nt
GenBank:CK706352 (1) 784 nt
GenBank:AW175557 (1) 589 nt
CITATIONS (2)