Transcript

hoxd10a-201

ID
ZDB-TSCRIPT-090929-4986
Name
hoxd10a-201
Previous Names
  • hoxd10a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000021045 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000021045|OTTDARG00000017442|ZDB-GENE-990415-116 hoxd10a|OTTDARP00000017735 hoxd10a-001 LG_ BX322661.17 Danio rerio protein_coding KNOWN, 1650 bp
ATTTCATTGGTGAGAGTGTCATGTGGTTGCAGAGAGACTC
GCTGGGTTATACAGGGATTGTTTTGCTAGATATGTCAGCT
TACAGAGGACACTTCTCTGCTTCTTAAAACAAAAAAAGAA
AACAAAAAAAAATCCAAAATGTCCTTTCCCAACAGCTCTC
CTGCAGCAAACACTTTTTTGGTAGATTCCTTGATTGGGGC
GTGCAGAACAGATTTTTATTCCAGCAGTAACATGTACATG
CCAGCAGCCACTGCAGAAATGGGAACCTATGGAATGCAAA
CCTGTGGACTCCTGCCGGCTCTTGGCAAACGGGGGGAAGT
AAACCACCAAAACATGGACATGACCGTCCACTCGTACATA
CCTCAAACTGATACCTGGGCAGATCCGAGCAGGTCCTGCC
GATTAGAGCAACCGCTCAACCAGATGTCCACCTGCACATT
TTCACAAAGCATAAAAGAAGAGACTAACTGTTGTATGTAC
TCCGACAAGAGAGCAAAGGTCAGTTCGTCTGAGATACCCG
CGTACTCCAGCCTGATTCCCGAATCATGTTCTGTTGATAG
TCCTGAGATTCCGGTCCCTGGCTATTTTAGACTGAGCCAA
ACTTACGCGACGGCGAAAAACCCGGACTATGACAACGAGA
CGATGAGCCCAAACACCACGTTAATGCAGCTGAACAGGGC
GACTCCAAAGGCACAGTCAACGCCCTTTGTCGAGGTGGAA
AAAAAGCTTGCGCACGATCGGGACACAAGGAGCTCTTCCC
CGGCGCAGAGTCCAGAGCCCAAAGTCAGCACGCTGGAGGA
GAAGAATTGCTCAACTGAGGCGTCTGTTTCCAGCCCCGAA
TTGCCACACAGAGAAGGCAAAGAATCTAAAAACGACACAC
CGACGAGCAACTGGTTAACCGCGAAGAGTGGAAGGAAAAA
GAGATGTCCATACACAAAACACCAGACCTTGGAATTAGAA
AAGGAGTTTTTATTCAACATGTATCTGACTCGGGAGCGCC
GTCTAGAGATAAGCAAAAGCGTCAACCTGACTGACAGACA
AGTGAAAATCTGGTTCCAAAACCGCAGGATGAAACTCAAG
AAGATGAGCAGAGAAAACCGTATCCGTGAACTGACGTCCA
ATCTCACTTTTTCGTGAGCACGCAGACAAGTGCAAATCAA
AAACCTAGTCCCTCATTTCGGTCCATCTATGTTCTCCTGT
GTAATGATGACATGATGGCAGTGTGCATTGTTTTTGGCTA
CTTTCACGTTGCAGTCTTGTGATCGTCGCTAAATCCTTGT
CATTTATTGCTGCATCTTTGAAATGTACATTTGAAATGTG
AAGCTTTGTGTAATTATCATGTTACACAGGGTATACAAGT
GGTGTTAGGTCTTAACTTATAAAAGAAGATAGAAACCGGC
TATTTCTGACGGCTTCATTTCAGCGGGGATAGAAGAAAAT
GTCGCAAACACATTTGCGTCAGCCTCTAAAAAACAAAAAG
TCTTGGACAAGAAAGCACATTTGAAAGTGAAGATTACCCA
TTCTTTCTCCAGTGAAAACGTACATTTGTCTCAAAATAAT
AATGTATTTCTGTATAATAGGTGTTTAAATATGTCTGTAT
AAGTGCATGTTTGTGGCATGTGGTCAATAGACTAATAAAT
TGATTATGTC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations