header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-4983
Transcript Name: hoxd13a-201
Previous Name: hoxd13a-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000021042 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000021042|OTTDARG00000017439|ZDB-GENE-990415-119 hoxd13a|OTTDARP00000017732 hoxd13a-001 LG_ BX322661.17 Danio rerio protein_coding KNOWN, 1687 bp
AACGGAGATGTTATTTTCTGCGTGCATTTTTCTTGGTTTT
GAGCCCATAACAGACATGAGTTAAATCCCATGCACTGAGG
AATATGGACGGAGGAGGACTGGATGAAGAGTTTATAAATG
TTTACCCATCTGCCTTCGGGACTCACTCAAGCCGGTGTAC
ATCAGGAGCGCCGGTGCTCTCCGCTGTTGATCGACCGACT
TCTGTATGCAATGAGTCTATCAGTCCTTACTTTTCTTTTC
CATCCAATATCGGCTCTGGCTCCTTCACGTTTGGATGCCA
TTTGGAAAACAGTTACAAAGTTCCACAGAACGCCGTGTTC
CCGCCTGGTGTTGCGAAGCAAAACGGACAGTTCGCCAATA
AACCCGTGGACCACGGTGAAGCCTCCAGCTGGCTTAAAGA
GTTCGCCTTTTATCAAGGCTGCGCGCGCTCCTATCCGAGA
ATCCCTGCCTTCATTGATCTACCTGTGGTTCAGAGAGCAA
TGATGGGAGATCTTAGACATGAGACTTGTTTGACAATGGA
AGGCCACCAACATTGGGACTGGTCAAACAATTGCAGCAGT
CAACTTTATTGCTTTCAAGACCAGACGCGGAGCCCGCATA
TCTGGAAACCATCATTAACAGAGGAAGCAGCAGCGGCTTC
ATTCTGTCAGCGCGGGAGAAAGAAGCGGGTTCCTTACACA
AAATTTCAGCTGAAAGAGCTCGAGCGTGAATACAACACCA
CTAAGTTCATTACAAAGGAGAACAGACGGCGGATCGCTTC
TTCTACCAACCTGTCTGAGAGACAAGTAACTATATGGTTT
CAAAACCGACGGGTCAAGGATAAGAAGAGACCTGACGTCT
GCATCAAATGTTAATCCCATTGATATCTTTGTAGAGTTGG
TTTGCATAAAGTAAAGAGTATATTATAGTGGGATACAATG
TAAATTATACTTAGAAGTAATGTTAAACAGTTGGTTGTAT
TTGTCAATCAATGAATTCTCCCGTCAATTTCCTCTTTCCC
ATACACTCAAAATGTTATACTCTACATTTCCTTAAATTTG
AGTGCATAACTGTGTGCCATAGTTGTTTATATCAGACTTT
TATATGCAAAAAAGCTATAACATTGATTTCAAATAAAATA
CAATTAATAATAATGTACTTTATATCTACAAGTTTAATTA
CATTGAACTGAATATAAAAGCATTATACAGAATACTATTG
TGAAACTATTAAATTCATACGATCTCGGCTGTTTTCCGCC
CCCCAAAATGTATTTATATTTCGTTAAGCTCACACCTCTA
TAAATGTAGTTTTGTGGTCTTTTTTAAAAGTAGAACTATA
ATTTTATGTTGGTGTATTTTGATAAGCATAACATACAAAT
AATTTGTATAAAAGAGTGCTTTAGATGTGAATGGTCTACA
TAAACACACGATCGCGTTAAAGTATAAACTGAGTAGGCAA
TTTGTGAATTTTAGACTCGGTGTCTGAATAAGTTAATATG
AAGTGTGCACTATTAATGAAAGCATATTTTAAGCACGCAA
TCAGTACAATTTTATACATGCACACACATAATACATTTCG
ATAGTTGTTTGGTAATCAAGTGACAAGTTAATTCTTCCGG
GGGAATAAACAACTCCTTAAAAATCTGCTCAAAAATGTGT
GCTGTATTTTAAGATAAAACTGCACTTATAAAAATACCTA
AACATCA

SEGMENT (CLONE AND PROBE) RELATIONSHIPS
hoxd13a-201 Contained in:
OTHER hoxd13a-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000021042 (1)
  • Ensembl_Trans:ENSDART00000082332 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC153652 (1) 1716bp
    GenBank:BC091996 (1) 1200bp
    GenBank:CK688667 (1) 599bp
    GenBank:AL915408 (1) 586bp
    GenBank:CK685424 (1) 540bp
    GenBank:CR926784 (1) 539bp
    CITATIONS (2)