ZFIN ID: ZDB-TSCRIPT-090929-4968
Transcript Name: msna-201
Previous Names: msna-001, rdx-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000021013 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000021013|OTTDARG00000017416|ZDB-GENE-021211-2 msna|OTTDARP00000017706 rdx-001 LG_none CR812469.6,CT027689.8 Danio rerio protein_coding KNOWN, 3780 bp
TCATCATCAGTGGCCGAGCCGCGTATAACGGGGCCTGTGA
GAATCCGGGCGGAGTTTAGTCAAGCGCGCTTTGGTGTGCC
TCCATCGGCTGGGCTGGGTGTGGTTTTCAAAACTCAGTTC
CGTTAGCAGGAAATCGACTGTGGGACCACCAGTACTTCTC
TGAGCGACAAAGACGCGGCGAAAAGTGAAACTTTGTCTCC
GGGGTCTGGAAGAGATTTGAGGAGAAGCTTTTCCACACAC
GAGCGGCGTCGCTTGTTGACTGTTGCGCGTGGACATCAGC
CGATGGGAAAAAGTTTGGCTTTCTGTTGACTTCATTGTAT
CAGCTTCAGTTTGTGACACATTCGTGAAGGAAGAGACCAG
ATACCGACAAAATGCCGAAAACGATCAGTGTTCGTGTGAC
TACAATGGATGCCGAGCTGGAGTTTGCCATCCAACCCAGC
ACCACAGGGAAACAGTTATTTGACCAGGTGGTGAAAACCA
TTGGGCTGAGGGAGGTGTGGTTTTTTGGTCTTCAGTATCA
GGACACCAAAGGTTTTTCCACCTGGCTTAAACTCAACAAG
AAGGTTACGGCTCAAGACGTCCGCAAGGAGAGTCCTTTGC
TGTTTAAATTCAGAGCAAAGTTTTACCCAGAAGACGTTTC
TGAGGAACTGATTCAGGAGGCCACTCAAAGACTCTTCTTC
CTTCAGGTTAAAGAGGGCATCCTGAATGACGATATCTACT
GCCCTCCTGAGACTGCGGTTTTGCTGGCCTCTTATGCTGT
ACAGGCCAAATATGCAGACTACAACAAAGATGCCCACACT
CCTGGATACTTGTCCAATGAGAAGCTGCTCCCACAGAGAG
TTCTGGAGCAGCACAAGCTGAATAAGGAGCAATGGGAGGA
AAGAATTCAGGTCTGGCACGAGGAGCACAAGGGCATGTTG
AGAGAGGACTCAATGATGGAGTATCTGAAGATAGCTCAGG
ATCTGGAGATGTATGGTGTGAATTACTTCAGTATTAAGAA
TAAGAAGGGATCAGAGCTGTGGCTTGGTGTGGATGCTCTG
GGACTCAACATCTACGAGCAGAATGACAAGATGACACCTA
AAATTGGTTTCCCCTGGAGTGAGATCAGGAACATTTCTTT
CAACGATAAGAAATTTGTCATCAAACCCATTGATAAAAAA
GCCCCGGACTTTGTGTTCTATGCCCAGCGTTTACGCATTA
ATAAGAGGATTCTGGCTCTGTGCATGGGGAACCATGAGCT
TTATATGAGACGCCGTAAACCAGACACCATCGAGGTCCAG
CAGATGAAGGCACAGGCCAAGGAGGAAAAGAACCACAAGA
AGATGGAAAGGGCATTGTTGGAGGATGAACGTAAAAAGAG
AGAGCAGGCCGAAAAGGAGAAAGAGAAGATTGAAAAAGAA
AAAGAGGAGCTGATGGAGAGACTCAGAGTAATCGAGGAGC
AGACAAGAAAAGCTCAGCAAGAGCTGGAGGAGCAGACCCG
CAAGGCGCTGGAGTTAGAGCAGGAGCGTAAACGTGCTCAG
GAGGAGGCTGAGCGTCTGGAGCGAGAGCGCCGTCTGGCAG
AAGAGGCCAAATCGGCTCTGCTGCAGCAGTCGGAGAGCCA
GATGAAGAACCAGGAGCATCTGGCAACTGAACTGGCAGAG
TTGACCTCTAAGATCTCCCTGCTTGAAGATGCCAAAAAGA
AGAAAGAGGATGAAGCATTAGAGTGGCAGACAAAGGCCAC
TATGGTGCAAGAGGACCTGGAGAAGACTAAAGAGGAGCTG
AAGAACAAAGTCATGTCATCCCATGTCACAGAGCCAGTGC
ATGGAGAAAATGACAACGATGAGGGTGACGAGAGCAGCGC
AGAAGCCTCTGCAGAACTGACCTCCGCAGCCGCCTATAAG
GACAGGAGCGAGGAGGAGCGCATGACGGAAGCCGAGAAGA
ACGAACGAGTGCAGAAGCATCTGCTGGCTCTTACTTCTGA
GCTTGCTAATGCTCGTGATGAGACCAAGAAGACCCAGAAT
GACATCATTCATGCAGAGAATGTACGAGCAGGACGTGACA
AATACAAGACGCTTCGCCAGATCCGCTCCGGAAACACCAA
ACAGCGAATCGACGAGTTTGAGTGCATGTAATGTACCAGC
GTCAGCCAGCAGGGGGAGCTACAGCCTGCTTTTTGCATCA
TGCCTGCAGAGGAACTACAGTACCCACAAACTACAGAACC
CCTTCAACAGAAAATAAAGCCAAAAATAGAAATAATGCTG
CACAATTCAAAAATCCCTTTAATTGATGAGTGTTGTTTGG
GTTACTTCATTATGATAAGGGAGTTTTTTTTCTTTTGTTG
GATTTGTGTTTTGATCTAGGTGTTACATTTTTTTTTAATA
TGGAAAACATTAACGGTTTACTGATTTAACCGAATTAAAG
GGTTTTAACTTCAGTAAAACTGGGAATCCTGTAGGAATTG
AAGTAAAAGAATAAAACATTCCAGTATTAAGATAGAAAGC
CTATGGAGTCAATCTAGTGCCATAAATACTTGCAAATTAA
AAGTTTGCAAACAAAAAATTAAGTATTGAGCAGAAACAAA
AATTTAATAAATGGAAATCTGCAAATCCCCAAAAATCATG
AAGCAAAAAATTATTTTTGAAAAAAAAAAATTACATAACC
AAATAAAGAACTGCAAAGGGAAAATTAAGTTTTGAAAAAT
AAAAATGAATTTTTTCAACAAAAACGAACTGCAAAAAAAA
CAAACTGTGCAAAAAAAAAAAAAAAAAAAAATTTCCAATA
TAAAAAAAAGTAACTAATTTTTTAATACATTTTTCGTTTC
GCGATTTTTGGAGATTTTCATTAAATTTTTGTTCAATTCG
TAATTTTTTGTTTACAAAACTTTCTTTCATTTTGCAATTA
TACATGACTTTACACTGACTCCATAAAAGCGCTCCAGAGA
CACGTCAGTGTGCCAAGACTGTATTTCAAAAGGGTATAGC
TGAATTATGATACTTCAGTGCCGTTGTGATGGTGTAATAG
CCTAGCTATTGTTTAACATTGTATCGATGTGCCTTTCTAA
TAAAACAATTACAGTATAGATTAACACACATGCCTAAGAT
CATGGTTACCTGCTCCTCTTCAACCACTCCCCATTAGAGC
TGTGTGTGTGTGAATGTGTGTGAGAGAGTGAGAGATCTGT
TGATAATTCCTTTAGTTATAGTTTCTCCAATCTGCAGGTT
GGTGGCTGCTCCCTGTTTGTGCCTTTTCACTGAAGGAAAA
AAGAAGAGAAAATATCAAACTGTATTTTTAGTGTAGTTTT
AATCCTATTCTTATTTTAAGCTGTTTTTTTTTTAAGAAAA
GACTATTTTGTTGTTTTTTGAGACATTTGAACATTTTTCT
CAGTATTATTTTGAAGAATCCTTAAATAGAATGAGAGTTA
AACAACATCATCTGGGGTTACATTTCTCCCTTTTCTTCTG
AGCAGTATTTACCCAGAGTGTACACACTTTTGAATAGCCC
TGCACTCGTAGGCAGTGCCTTAGTTGTTGTTTTTATGATC
TATATCCATTTTATTTTTTATTCCTGTGGCAATATGCTGC
AAAGAAGCAATATGACATGTTTCCAAGCTGCTTTGGAAGA
ATTCTTCAGTCAGATCCTGATCTTAAAATATGAAGCTTGT
TTTATCACATAGAGCGTTCTTGTTAACTGGGCAGTTTCTT
GTCCAAAGGCTGCAGGTGGGTTTTTTGTTAACCAATCAGA
AAAGATTGCTGCTTTATTTTTCCCCCCCCATTGCAACTGT
CAATAAAATAATCAAAAACA

SEGMENT (CLONE AND PROBE) RELATIONSHIPS
msna-201 Contained in:
OTHER msna-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000021013 (1)
  • Ensembl_Trans:ENSDART00000016214 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC081551 (1) 3635bp
    GenBank:BC049479 (1) 1532bp
    GenBank:CF265989 (1) 1130bp
    GenBank:CO936479 (1) 907bp
    GenBank:CN832215 (1) 876bp
    GenBank:CO923645 (1) 875bp
    GenBank:CN326444 (1) 855bp
    GenBank:CO913562 (1) 854bp
    GenBank:DT079307 (1) 840bp
    GenBank:CK352675 (1) 815bp
    GenBank:CK018545 (1) 813bp
    GenBank:DR717915 (1) 797bp
    GenBank:CV112255 (1) 788bp
    GenBank:CA975593 (1) 780bp
    GenBank:CO924152 (1) 779bp
    GenBank:BI890773 (1) 776bp
    GenBank:CK018466 (1) 768bp
    GenBank:CK706377 (1) 767bp
    GenBank:CK396875 (1) 764bp
    GenBank:DR724621 (1) 762bp
    GenBank:CK699062 (1) 757bp
    GenBank:DN862932 (1) 755bp
    GenBank:CO915709 (1) 749bp
    GenBank:DT073447 (1) 743bp
    GenBank:CV105275 (1) 736bp
    GenBank:CK680451 (1) 727bp
    GenBank:BF937912 (1) 703bp
    GenBank:DN901950 (1) 682bp
    GenBank:BI887739 (1) 657bp
    GenBank:BQ260755 (1) 642bp
    GenBank:CK689684 (1) 585bp
    GenBank:CK704172 (1) 583bp
    GenBank:AI958444 (1) 569bp
    GenBank:CK675841 (1) 563bp
    GenBank:DT066504 (1) 554bp
    GenBank:AL918485 (1) 535bp
    GenBank:CK694065 (1) 505bp
    GenBank:CB359448 (1) 482bp
    GenBank:CK693835 (1) 347bp
    GenBank:CK678012 (1) 329bp
    CITATIONS (2)