header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-4954
Transcript Name: sdf2l1-201
Previous Name: sdf2l1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000020970 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000020970|OTTDARG00000017377|ZDB-GENE-040808-46 sdf2l1|OTTDARP00000017669 sdf2l1-001 LG_ BX957246.7 Danio rerio protein_coding KNOWN, 1513 bp
GTCATGCTGCGATTGGCTAGAAAGCGTGTCAGCGTTTGAA
TGGGACTCTCCGTATCCATTTTTCTGTGATGTACATAGAC
GCCGGCTGCAATGATGGGGCCGTTAAGAGTCATGTCCGTG
TTTTTGGATTTAATTTTAGTGTGTTTGGTGTTTTCTCCGT
GCGGCGCTCGTGATGTGGACTCCAGCTACGTGACGTGCGG
ATCTCTGGTCAAACTGATGAACACTCGGCACAGCGTCAGA
CTGCACTCGCATGATGTCAAATACGGCTCAGGAAGCGGGC
AGCAGTCAGTAACGGGTGTGGATTCAGCTGATGATGCCAA
CAGCTACTGGCGTATTCGTGGAAAGCCAGGCAGCATTTGC
CAGCGCGGGGCACCCATTCGATGCGGACAGGCCATCCGAA
TTACACACATGACCACTGGACGCAACCTACATTCCCATCA
CTTCAGCTCGCCGCTGTCTAACCACCAGGAAGTGAGTGCG
TTTGGGGAAAATGGAGAAGGAGACGATTTGGATGTGTGGA
ACGTCCAGTGCAGTGCAACATACTGGGACCGTGAGGACGC
AGTGCGATTTAAACACACCGGCACCGAGGTTTTCCTCAGC
GTTACCGGTGAGCAGTACGGTCATCCAATCAGAGGCCAGC
GTGAGGTCCATGGAATGCCTTCGCCCAATCAGCATAACTA
CTGGAAGGTGATGGAGGGGGTTTTTATTCAGCCCAGCAGT
GACCCTATTCACCACGATGAGCTCTGATGATGCTGATACA
TCATTATTATGAGCGACTGAGAACTGCGCAAAACTTCTCT
ATATACATTTATCGGTCCAATTCTTATAGATGTGTTGCAG
ATTTATCACATTTGCTTTGAAGACGTCACACGCAATATGT
ACATCACAGACAAATAGATGAATTGGTTTGTTTTACTGGA
TTTCTTTTGAATGGAATTTTGTTATTTGTACATAAGGGAG
TAAAAGGGCAAGGTTTCGGGCCACAAAATCGACTTATTTA
TTTTAGAATTAAATATTGAACTGGAACAAATTACATTATT
GACTTGCAAAATCATTTGAGCCACTGTGAAATCCTGAAAT
ATTTCTGGATTCACTGTGGGGAAAATGTAAAATGGCTATT
TCTGTTTTTGGTAACACTTCACAGCAAGGTTCAGTTGGTT
AATGCATTAATTTAATACATTTATTACATGATGTACTCAT
TTTAAACTGATATGAATGATATTGCTAAATCCGATACATT
GCATTTATGTTCAAAACAAATACATTATTTGATTGTAATA
ATAAGTAAACATTAGAATGAACATGCGTTGATGAATGAAC
GCCTTAGTAGTTTTCATTTCATGTGCTTAACTAATGTCAA
CAAATTAAACCTTATTGTAAAGGGTTACAACGTTTTTATT
TCCTAATATGACTGTGTTCTGTAGACTGTAATTTTCAATC
CCTTTCATACTGTATGTGACCTGATATGTACATAAATTGA
TAAAAGCGTGAATAAATTTTTTTGAAATATTTA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
sdf2l1-201 Contained in:
[BAC] CH211-89F7 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000020970 (1),  Ensembl_Trans:ENSDART00000143364 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC078401 (1) 1460 bp
GenBank:CN512566 (1) 932 bp
GenBank:CK865303 (1) 879 bp
GenBank:CK018987 (1) 820 bp
GenBank:CO798174 (1) 784 bp
GenBank:DT068904 (1) 775 bp
GenBank:DR715879 (1) 769 bp
GenBank:DR727445 (1) 745 bp
GenBank:BM571725 (1) 548 bp
GenBank:BM571957 (1) 540 bp
GenBank:AI793850 (1) 492 bp
GenBank:AW232812 (1) 490 bp
GenBank:CK681957 (1) 490 bp
GenBank:CK684592 (1) 473 bp
GenBank:CK693075 (1) 269 bp
CITATIONS (2)