Transcript

sdf2l1-201

ID
ZDB-TSCRIPT-090929-4954
Name
sdf2l1-201
Previous Names
  • sdf2l1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000020970 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000020970|OTTDARG00000017377|ZDB-GENE-040808-46 sdf2l1|OTTDARP00000017669 sdf2l1-001 LG_ BX957246.7 Danio rerio protein_coding KNOWN, 1513 bp
GTCATGCTGCGATTGGCTAGAAAGCGTGTCAGCGTTTGAA
TGGGACTCTCCGTATCCATTTTTCTGTGATGTACATAGAC
GCCGGCTGCAATGATGGGGCCGTTAAGAGTCATGTCCGTG
TTTTTGGATTTAATTTTAGTGTGTTTGGTGTTTTCTCCGT
GCGGCGCTCGTGATGTGGACTCCAGCTACGTGACGTGCGG
ATCTCTGGTCAAACTGATGAACACTCGGCACAGCGTCAGA
CTGCACTCGCATGATGTCAAATACGGCTCAGGAAGCGGGC
AGCAGTCAGTAACGGGTGTGGATTCAGCTGATGATGCCAA
CAGCTACTGGCGTATTCGTGGAAAGCCAGGCAGCATTTGC
CAGCGCGGGGCACCCATTCGATGCGGACAGGCCATCCGAA
TTACACACATGACCACTGGACGCAACCTACATTCCCATCA
CTTCAGCTCGCCGCTGTCTAACCACCAGGAAGTGAGTGCG
TTTGGGGAAAATGGAGAAGGAGACGATTTGGATGTGTGGA
ACGTCCAGTGCAGTGCAACATACTGGGACCGTGAGGACGC
AGTGCGATTTAAACACACCGGCACCGAGGTTTTCCTCAGC
GTTACCGGTGAGCAGTACGGTCATCCAATCAGAGGCCAGC
GTGAGGTCCATGGAATGCCTTCGCCCAATCAGCATAACTA
CTGGAAGGTGATGGAGGGGGTTTTTATTCAGCCCAGCAGT
GACCCTATTCACCACGATGAGCTCTGATGATGCTGATACA
TCATTATTATGAGCGACTGAGAACTGCGCAAAACTTCTCT
ATATACATTTATCGGTCCAATTCTTATAGATGTGTTGCAG
ATTTATCACATTTGCTTTGAAGACGTCACACGCAATATGT
ACATCACAGACAAATAGATGAATTGGTTTGTTTTACTGGA
TTTCTTTTGAATGGAATTTTGTTATTTGTACATAAGGGAG
TAAAAGGGCAAGGTTTCGGGCCACAAAATCGACTTATTTA
TTTTAGAATTAAATATTGAACTGGAACAAATTACATTATT
GACTTGCAAAATCATTTGAGCCACTGTGAAATCCTGAAAT
ATTTCTGGATTCACTGTGGGGAAAATGTAAAATGGCTATT
TCTGTTTTTGGTAACACTTCACAGCAAGGTTCAGTTGGTT
AATGCATTAATTTAATACATTTATTACATGATGTACTCAT
TTTAAACTGATATGAATGATATTGCTAAATCCGATACATT
GCATTTATGTTCAAAACAAATACATTATTTGATTGTAATA
ATAAGTAAACATTAGAATGAACATGCGTTGATGAATGAAC
GCCTTAGTAGTTTTCATTTCATGTGCTTAACTAATGTCAA
CAAATTAAACCTTATTGTAAAGGGTTACAACGTTTTTATT
TCCTAATATGACTGTGTTCTGTAGACTGTAATTTTCAATC
CCTTTCATACTGTATGTGACCTGATATGTACATAAATTGA
TAAAAGCGTGAATAAATTTTTTTGAAATATTTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations