header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-4953
Transcript Name: ube2l3b-201
Previous Names: ube2l3b-003, ube2l3l-003

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000020968 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000020968|OTTDARG00000017373|ZDB-GENE-030131-662 ube2l3b|OTTDARP00000017667 ube2l3l-003 LG_ BX957246.7 Danio rerio protein_coding KNOWN, 749 bp
AGCGCGCACGAGCTCATGATTCCATCGCTGCGCCGCGCGG
TGCATTCTGGTAGAAGTTGAAAGATTCAAGATGGCGGCGA
GCAGGAGACTACACAAGGAACTTGAAGAAATCCGCAAGTC
TGGGATGAAAAACTTCCGTAACATTCAAGTTGATGAATCA
AACATATTGACATGGCAAGGCCTTATTGTTCCAGACAACC
CTCCATACGACAAAGGGGCATTCAGGATCGAGATCATCTT
CCCTGCAGAATACCCTTTCAAACCACCCAAGATCACGTTC
AAAACGAAGATCTACCACCCCAACATTGACGAGAAGGGAC
AGGTCTGCCTGCCTGTCATTAGTGCAGAGAACTGGAAACC
AGCCACCAAAACTGACCAAGTAATCCAGTCGCTCATCGCC
CTGGTGAACGACCCACAGCCAGAACACCCTCTGAGGGCCG
ACCTAGCAGAAGAATACTCAAAAGACCGTAAAAAATTCTT
TAAGAACGCAGAAGAGTTTACAAAGAAACACGGCGAAAAG
CGGCCAGTGGACTAACAATACCTGACAAGTGTGTAGCCCC
AGACCCCCTCCTCCTCCTCCTTTTCTGATCCTCTCCCCCT
TCGCTCTGCTACCCAAACGCCATCCTTTATCCCTTCCTCC
AGCTTTTCCCCTCCTTCTCCTTTCCACGTGTCACTGTAGT
CGAGCTGGAGAAGATCAGCGCCGCTGCAGCCTCCGTCTTG
AAGCAGGACGCCCTGAGGACATCCCATCA

ube2l3b TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA ube2l3b-201 749
ube2l3b-202 (1)    Ensembl 2320
ube2l3b-203 (1)    Ensembl 919
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ube2l3b-201 Contained in:
[BAC] CH211-89F7 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000020968 (1),  Ensembl_Trans:ENSDART00000004539 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:CN016368 (1) 950 bp
GenBank:CK866061 (1) 947 bp
GenBank:CN014475 (1) 947 bp
GenBank:CK873080 (1) 910 bp
GenBank:CN023431 (1) 895 bp
GenBank:CO918749 (1) 874 bp
GenBank:DT056782 (1) 874 bp
GenBank:CN511989 (1) 860 bp
GenBank:CN013878 (1) 838 bp
GenBank:CV487120 (1) 835 bp
GenBank:CK353982 (1) 831 bp
GenBank:DN836731 (1) 822 bp
GenBank:CK681313 (1) 820 bp
GenBank:CO914768 (1) 817 bp
GenBank:CV108213 (1) 805 bp
GenBank:CV112582 (1) 793 bp
GenBank:CV103392 (1) 778 bp
GenBank:CV109705 (1) 761 bp
GenBank:CK678973 (1) 753 bp
GenBank:CB365582 (1) 165 bp
CITATIONS (2)