Transcript

ube2l3b-203

ID
ZDB-TSCRIPT-090929-4952
Name
ube2l3b-203
Previous Names
  • ube2l3b-002
  • ube2l3l-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000020967 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000020967|OTTDARG00000017373|ZDB-GENE-030131-662 ube2l3b|OTTDARP00000017666 ube2l3l-002 LG_ BX957246.7 Danio rerio protein_coding KNOWN, 919 bp
AGGTAGACGTCCAAACCTAATACTTTTTTAATCGTAAATA
ATTACTAATCGCTCACGACGACGCGATGGATGGTTAAACA
TGAAGTTTCTCTAACCGAAAGGGCGATTCGGACGTTTGTT
TAAGCTTAATCTGCGTTAGTACAGGCGGTTCTCTTACTCG
ATGACTCGGCTCGCTCCGCGTTTCCAAACATGAAGGAGGA
AAGCGCCGGTGGAGGCCGCGGGACTCAACAACAGGTTTTT
GGGGTCGAGATCGTGGAGGCAGATGGGCAAATAGCATGTT
ATAGTAGGCTTCAGTGTCTTAACCTGTCTCTTCATTCATT
GACCGAACTTGAAGAAATCCGCAAGTCTGGGATGAAAAAC
TTCCGTAACATTCAAGTTGATGAATCAAACATATTGACAT
GGCAAGGCCTTATTGTTCCAGACAACCCTCCATACGACAA
AGGGGCATTCAGGATCGAGATCATCTTCCCTGCAGAATAC
CCTTTCAAACCACCCAAGATCACGTTCAAAACGAAGATCT
ACCACCCCAACATTGACGAGAAGGGACAGGTCTGCCTGCC
TGTCATTAGTGCAGAGAACTGGAAACCAGCCACCAAAACT
GACCAAGTAATCCAGTCGCTCATCGCCCTGGTGAACGACC
CACAGCCAGAACACCCTCTGAGGGCCGACCTAGCAGAAGA
ATACTCAAAAGACCGTAAAAAATTCTTTAAGAACGCAGAA
GAGTTTACAAAGAAACACGGCGAAAAGCGGCCAGTGGACT
AACAATACCTGACAAGTGTGTAGCCCCAGACCCCCTCCTC
CTCCTCCTTTTCTGATCCTCTCCCCCTTCGCTCTGCTACC
CAAACGCCATCCTTTATCCCTTCCTCCAGCTTTTCCCCTC
CTTCTCCTTTCCACGTGTCACTGTAGTCGAGCTGGAGAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations