header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-4952
Transcript Name: ube2l3b-203
Previous Names: ube2l3b-002, ube2l3l-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000020967 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000020967|OTTDARG00000017373|ZDB-GENE-030131-662 ube2l3b|OTTDARP00000017666 ube2l3l-002 LG_ BX957246.7 Danio rerio protein_coding KNOWN, 919 bp
AGGTAGACGTCCAAACCTAATACTTTTTTAATCGTAAATA
ATTACTAATCGCTCACGACGACGCGATGGATGGTTAAACA
TGAAGTTTCTCTAACCGAAAGGGCGATTCGGACGTTTGTT
TAAGCTTAATCTGCGTTAGTACAGGCGGTTCTCTTACTCG
ATGACTCGGCTCGCTCCGCGTTTCCAAACATGAAGGAGGA
AAGCGCCGGTGGAGGCCGCGGGACTCAACAACAGGTTTTT
GGGGTCGAGATCGTGGAGGCAGATGGGCAAATAGCATGTT
ATAGTAGGCTTCAGTGTCTTAACCTGTCTCTTCATTCATT
GACCGAACTTGAAGAAATCCGCAAGTCTGGGATGAAAAAC
TTCCGTAACATTCAAGTTGATGAATCAAACATATTGACAT
GGCAAGGCCTTATTGTTCCAGACAACCCTCCATACGACAA
AGGGGCATTCAGGATCGAGATCATCTTCCCTGCAGAATAC
CCTTTCAAACCACCCAAGATCACGTTCAAAACGAAGATCT
ACCACCCCAACATTGACGAGAAGGGACAGGTCTGCCTGCC
TGTCATTAGTGCAGAGAACTGGAAACCAGCCACCAAAACT
GACCAAGTAATCCAGTCGCTCATCGCCCTGGTGAACGACC
CACAGCCAGAACACCCTCTGAGGGCCGACCTAGCAGAAGA
ATACTCAAAAGACCGTAAAAAATTCTTTAAGAACGCAGAA
GAGTTTACAAAGAAACACGGCGAAAAGCGGCCAGTGGACT
AACAATACCTGACAAGTGTGTAGCCCCAGACCCCCTCCTC
CTCCTCCTTTTCTGATCCTCTCCCCCTTCGCTCTGCTACC
CAAACGCCATCCTTTATCCCTTCCTCCAGCTTTTCCCCTC
CTTCTCCTTTCCACGTGTCACTGTAGTCGAGCTGGAGAA

ube2l3b TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA ube2l3b-201 (1)    Ensembl 749
ube2l3b-202 (1)    Ensembl 2320
ube2l3b-203 919
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ube2l3b-203 Contained in:
[BAC] CH211-89F7 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000020967 (1),  Ensembl_Trans:ENSDART00000146136 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:CN024280 (1) 949 bp
GenBank:CN022560 (1) 930 bp
CITATIONS (2)