header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-4950
Transcript Name: tctn2-202
Previous Names: tctn2-001, si:ch211-89f7.3-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000020963 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000020963|OTTDARG00000017372|ZDB-GENE-030131-751 tctn2|OTTDARP00000017662 CH211-89F7.3-001 LG_ BX957246.7 Danio rerio protein_coding NOVEL, 2292 bp
GAAGAAGAGGATTCACTGCCTTTACCAACGCGGTTATTAT
GAGACACTTTTCATCTTTCCATATTGGGTTTTATTTCACA
TGTATAATATTTACGTTCTTAAATGACGGAACAGTCTGTA
ATGTTGTGTTTCAGCCTGCGTTCATTCAGGCATCTGGTCC
AAAAATATCATCTTTTCTGGTTGGAAACGTGTCGGGCATT
TCATTCAGTCTTAGTGCTGTTTCTTCGTCAAATGCAACAG
GTAGCATCCTTCCACCATCCTGTTTGCCGGTTTATCAACC
ACAGTGGAATCTTTCCTATGAATTAATTGGGAAGAATGCC
TTTCTGGTGCACGTGAGTCTGAACCGCAGTCTCCAGCTGT
GTGGGAATGAAACCTCCATCTCGGACTGCTGTCTGGAGTT
GCTTTGTGTCCAGGAGACTCTGCTTGTGTCTGCTTGTGTG
GATGAAACACCTAAAGCCTCCCTCATCATACAGACCCAGA
TTTATGCCCAGATCCACCCCAGTAAACCTCCATCTGTAAA
TAAAACAGTCATTCCCAACCAAGTATTTCAGCCGCTCGGC
CAGTGCCCGTGTGACGTTTCTCCAGGCGAGTGTGACATAC
GCTGCTGCTGTGATCAGGACTGTACTCGGGAAGTCCTGGG
GCTCTTTGCAACTCAGTGTTTTCTTGGACCGTACGGGGGA
AGTTTCAGTCCTGTTCCAGAGTATCAGTGTTCTGCTCAGC
CTTCTGAAAATGACCCTGATTGGTTCCCCTTCCTCTGTGT
CATCTCGCCCTCCTACAACAACCCTTTTCTGGGACTTTTT
TATCATGGTGGAACTGTCTCTCCAAAACCAAGTCCATCAT
TCCAAGCCCCACAGATGACAGCTACTCTTCCCCCCATAAA
CTACCGCCAAGGGGATCCAATATTCACCAAGGATGACAAA
TACTTCACCATCCCACAGAACACGGGAACAGGTCAGTGTG
TGGAAAACGCACCAGTGGCATTTTTGGAGAACTTTGAGTT
CCAGTGTGTGAGGAGGCTTCAGTTTTGTCCATCTCCATCT
GATGACCTGAGGGTGGATGTTAAAGATGGACAGGGAGGTG
TGATAGCGGTCAGTGTTGTGGATGATGTAGCTGACAACAT
CAGATTATTTGTGTCAAATTCTCCTGAGGTCACTTCAGAG
CCACAACAGTGTGATAATGTCGTTGTGTCCTTGCGTTACA
CTTTTTACTGGAGAGAGAACGGTCTCACCGCCATTGCTGT
GACACGAACCACTGCAAACATCACTGTACCTGTTTTTTTT
TCTTCAGTAACTTTGACAAGTAGATATTCTGCTGTGTTTG
TGAATGGAAACGAGACCTCTCAGTCGTACTCCGGTTACCA
AGTGATGAGGCCCGTGATTGGTGGTGTTTTGGACTCTGAA
ACAGGAGTTGTACAGAGGACCCAGATCAGTCTGTGGCAGC
CAGCTGGAGATGGCCTGTGCTCTTCTGCTAAACTGAGATC
AGCTCTGTTTGGGATCAACTCCACATCAGGCTGTGTGGTT
CCTGTGAGAGAAACGCTGCGTTCTCTTCTAGATGGATTAG
TGACCGCTACACTCGTCTCCACTTCAGGAAAACCAGACTT
TTACAATTTGACGGACTGGGTCAACATTACTACATCGCAG
CAGAACCAGAGTCAGTCAGCAGAGGGCAGCAAAGGAGAGT
GTTCAGCCGTGCCCACTCACCTCCACATCCACGTGAAGAG
CAGCATCATGGAAATAGTTCAGGGTGTTCCTCAAATGTTT
ATCCAGTCCATGCAGATCAGTTTCATAGAGAGGACATGGA
AGATTGAGTGTGGTGTGGGAATGATGGACCCCTGTTTGAA
CCCAGAGCTCATGCAAAATTTCCCAGTCACCTCTTCAGTG
ACGTTTACTGACCTTTCTCTTTATTCACAACCACCTAGAT
CCAGGTTCAGCATTAACTTCACAGAGTTTGACTGTGACAG
GAATGATGTTTGCTGGCCTGAACTGGCCTTTCCTTTCACA
ACATACTACACTGGCGAGCCTTATTCTGAGGCTCTGGCTA
AAGGTCTGACTCTTGTATTCTTCTTCATCGCGGCGTCCGT
TTTGGGAACCCCGTGGAGGCAAATCCGACAGGCCTGGAGG
AATGCTTGATCAGGACAGAGAAAACTGAGCTGTAAATAAC
TGTGAACATACAATTATTTATTTTTCTTTTCTAGTTTGTA
CATTTTCCTACATTATTTATAAAGTTTTGTCGATTGAACT
ATGCTTTTTAAATGAAATTGTGAATACAAAATAAAAATAC
ATGTTTTATATG

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
tctn2-202 Contained in:
[BAC] CH211-89F7 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000020963 (1),  Ensembl_Trans:ENSDART00000135921 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:CV120504 (1) 817 bp
GenBank:AI959117 (1) 557 bp
GenBank:AW343816 (1) 518 bp
GenBank:AW423036 (1) 506 bp
GenBank:AL923896 (1) 427 bp
GenBank:AI461383 (1) 408 bp
GenBank:AI444189 (1) 322 bp
CITATIONS (2)