header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-4949
Transcript Name: ccl19a.1-201
Previous Names: ccl-c5a-001, ccl19a.1-001, si:ch211-89f7.4-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000020962 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000020962|OTTDARG00000017371|ZDB-GENE-060526-181 ccl19a.1|OTTDARP00000017661 CH211-89F7.4-001 LG_ BX957246.7 Danio rerio protein_coding PUTATIVE, 949 bp
CCGCGCGGCGCAGCGATGGAATCATGAGCTCGTGCGCGCT
TGGGAAACTTCGGATGATCCGGGATCAGATTTACCATTTG
CGCACAGCCGACGGAACAAGCAAAACAAGAGCCCCTATAA
CGATCTCAGATGAGCTCATACTACACCGCCAACATGCTTC
CCAGACTGAGAACCGATAAAACAAAATTGGTCCTGCACGC
TCCCATGGTTTGCTGGAAATTACAAGACCAGACTTGCTTC
CCCTTCGGCAATTTCAGAAAGGGGCAGGCCTTCAGTCATA
GTGAAACCTTAGAGTGTGTATAAACCAGGGCAGCGATAGA
GCGGTGAGAGGAGAGACTCGCAGATCTTTCAGACTCAACA
CTCTTCTAGCTTCTCCAGAACTGCAATGGCTTCATCCATC
ATGTCTGCGTTCTGTCTGGCTGTTTCTGCTTTGCTGCTCT
GTTTCTACAGCAGCCCGACAGTGGCTCAGGCAGATTTAGC
ACTGGACTGTTGTCTGACGGTCAGCCCAAGAGTCATTCCC
AAACACGTTATTCTCGCTTACCAGAAGCAGAGCAGAGGTG
ACGGCTGCCCACGTGATGCTGTTATATTCATCACCAGGAA
AGGATTGAACCTTTGTGCTCCGCCTGCCAGTGAAGAGTCG
TGGGTAAGAGACACCATGACGTTTCTGGACAAAAGGAGGG
AAAAGTGCAAAGAAACAAGGTTCATCGAGAGACGCTGTCA
TGCTCTGAAATTTATGAAGTTCTGAGTGAACACATACTGT
GTGCACAGTAATATATGCATTAAATGGCAGCTGTTTATGC
TAATGAAAAGAGTACATTCCTCCTAAATATCTCTTTGTTT
CTTCAGTTGTTTCTATTTCATCATTCAGTTTGCGATTTGT
AAATTCACACAAATACTTTGTTACAGTCATATTTTTGCAT
TTTAAGTGAATAAAGTCTTTGACATCATT

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ccl19a.1-201 Contained in:
[BAC] CH211-89F7 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000020962 (1),  Ensembl_Trans:ENSDART00000099611 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC122386 (1) 972 bp
GenBank:DT873831 (1) 655 bp
GenBank:DN891274 (1) 583 bp
GenBank:CO352795 (1) 580 bp
GenBank:BQ479755 (1) 549 bp
GenBank:BQ479531 (1) 544 bp
GenBank:CR930712 (1) 539 bp
GenBank:AL921204 (1) 534 bp
GenBank:CO360769 (1) 416 bp
CITATIONS (2)