Transcript

esr2a-202

ID
ZDB-TSCRIPT-090929-494
Name
esr2a-202
Previous Names
  • esr2a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000005324 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000005324|OTTDARG00000004945|ZDB-GENE-030116-2 esr2a|OTTDARP00000004793 esr2a-001 LG_ BX255911.8 Danio rerio protein_coding KNOWN, 3249 bp
TCGTCGACTTAAAGCAAGCCTTACAGTGGACCATCTGCTG
GCATCAGCTGCAACAGGTGCTTGTTCTTGTTCTGTGCTCA
GGGTATGTTTTGGCCGCTTGCCTGTCTGCACTGAACAAGA
GTTCAAAAGTCCTCACTGAGTCACCGTTGCCGTCTGGAGA
GACAGTGTGGTATACCGCCTTGCTCACTGTCTTGCTACAA
CACTGAGGAGTATCGAGGACTGAGAAGTTCACCATGACAC
ACATCAACAGTCCCCCGTTACTGATGCGACAGCTCTGAAC
TCATCCGCCTTCACCATGTCCGAGTATCCCGAAGGAGACA
GTCCTCTTCTTCAGCTGCAGGAAGTGGACTCAGGCCGGGT
GGGAGGTCACATCCTCTCCCCCATCTTCAACTCATCCTCT
CCATCTCTGCCAGTGGAGAATCACCCCATCTGCATCCCAT
CGCCCTACACAGACCTTGGCCACGACTTCAGCACTCTGCC
CTTTTACAGTCCCGCTCTGCTGGGGTACAGCACATCGCCT
TTATCGGACTGCTCGTCTGTGCGCCAGTCGCTAAGCCCGA
CTTTATTTTGGCCACCTCACAGCCATGTTTCCTCACTCAC
ATTGCAACAACAGAGTCGACTTCAACAGAACCATGCTACT
AGTGGGACTTGGACCGAACATACACCACATGATCATGTTG
AAGAGGAAAACAGCAAACCACTGGTAAAGCGGGTAGCAGA
TACAGAGGAGACGTCTGTGTCTCTGAGAGGTAAAGCTGAC
ATGCACTACTGTGCCGTCTGCAGTGATTACGCCTCTGGAT
ATCATTATGGAGTGTGGTCGTGTGAAGGCTGCAAAGCCTT
TTTCAAGAGGAGTATACAAGGACACAATGACTACATCTGT
CCTGCCACAAACCAATGCACTATCGACAAGAACCGCCGCA
AAAGCTGCCAGGCCTGCCGACTCCGAAAGTGCTATGAAGT
TGGAATGATGAAATGTGGGTTGCGGCGAGATCGTAGCAGC
TACCAACAAAGAGGAGCACAGCAGAAACGACTGGTCCGAT
TCTCTGGCAGAATGAGAATGACTGGTCCGAGGTCTCAAGA
GATAAAGAGTATCCCGCGTCCTCTCAGTGGGAATGAGGTG
GTGCGCATATCACTGAGCCCAGAGGAGCTCATCTCCCGGA
TCATGGAAGCAGAGCCGCCGGAGATTTATCTCATGAAAGA
CATGAAGAAGCCCTTCACTGAGGCAAACGTCATGATGTCA
CTGACCAACCTGGCTGACAAAGAGCTCGTGCACATGATCA
GCTGGGCCAAGAAGATCCCAGGTTTTGTGGAGCTCAGTCT
TTTCGATCAGGTGCATTTGTTGGAGTGCTGCTGGTTAGAG
GTGCTTATGCTGGGATTGATGTGGCGCTCCGTTAATCACC
CTGGAAAGCTCATTTTCTCTCCAGACCTCTGTCTCAGCAG
GGATGAAAGCAGCTGTGTGCAGGGGTTGGTGGAGATCTTT
GATATGCTGCTGGCAGCCACGTCCAGATTCAGAGAGTTGA
AGTTACAGAGAGAAGAGTACGTGTGTCTCAAAGCCATGAT
CCTCCTGAACTCCAACATGTGTCTGGGCTCGTCTGAGGGA
GGAGAAGATCTGCAGAGCCGCTCCAAGCTGCTGTGTCTGC
TGGACTCGGTGACTGACGCTCTGGTTTGGGCCATCTCGAA
GACCGGCCTTAGCTTCCAGCAGCGCTCCACCAGACTGGCC
CATCTGCTCATGCTGCTCTCACACATACGCCACGTCAGTA
ACAAAGGCATGGACCACCTGCACTGCATGAAGATGAAGAA
GATGGTTCCTCTGTATGACCTGCTCCTGGAGATGCTGGAC
GCTCACATCATGCACAGCTCCCGTTTGTCTCACTCCGGCC
CTCGAGCCCCTGCTGCTCACAAAGACAACAAGAGTGTCCA
GGAGGCCTTTCCCTGCAGCTCACAGCACGGACCCTAAACA
CGGCCCTCACAGTCACACGAACACAGTACTTAAGGATGAT
CTGTAGTTTCGGGAGGATGGACAACCAAAACACCCACATA
AAAGCAAGGAGTAGGATTTCACAAGACGAAAAGCATCATG
GATATCTTGAATGTTTTTCCTGTTTTTAAATGTTGGCAAT
TGCTGTGAAATCTCTTTATTGTTTCCACACAACTCTGACA
ACTTTTTTATGATTTTATGTAGCACAACTGCAAAAGAAAA
GAAAAAAAGAAATGAATACCCACATTGGATTTCAAGAGAT
TTTTGGAAACTTCATTACACGGTGAACTATAATTTCTGGC
ATTATATGCATAATGGAGGCCATCTAGTAGGAGAAAACCA
AGTAAACCAATCATGCCCACCTTCTTTTTTAAAAGAACCA
GTTCAAACTCAATTGAGAGAGTGCATTGGTGCCATGACCC
GGATGACAGTAGGTTTTATTAAATCTGTCATCTCTGGCCT
TGAGAGACTGTGGCCTTTAGCATTAGCCTTGTTAGCAGCC
TGCCTCTCAAGTACTCACCAGTTCAGATCCCGCTGTAAGT
AGGACGGGGTTATAATGTCCATGAAAGTTTTGGCCTCATT
TTCATGACATCCGTGACAACATGGACAAGAGCAGTGTGCG
ATCTCTACTTTTTCTCTTTCTTACATAAGCTTGCTGCTTT
CACATTTTGTAAAATGAAACAAAATATCGTAAACTCATTA
CTTTCGACAATACTGGCAGTAAAATCAAATTTGATTTAGT
CTGTTGTAAATGGACAGAATCATTCCTGATAGATGAGACA
AAGCATTGTATGCTGAGTGAGCAAACCATATTCTGGACTA
AGGGCAAGCAGTATTTTAGACTTACAAAACAAAAAACCTG
AATGATTGAATGAATGTCAGCTGGATGTTTCATTTACATC
TGTTGTTATTGAGAAATGGAACCATTGCAAAATGGCCTCG
TGCACATTTTAGTGATTAATTCTTTTTTGCAAACAAACAT
TTATGTACAGGAGTGACAGCCGCATTTTACAGCCATCGCC
GTGACCATATCTTGAACATTGGAGGGTTTGTGTTAGAAAT
TATAAAGTAGGACATTTCAGGCCTAATTCTAGTGGAAAGG
TATTTGCAAAAAAAAATTACAAAATCAATTTGTAAACCTA
ATATGTTTCACATTCAGTTAGAAAAGACTAATTAGGTAAC
ATCTCAGCTCACAATGATGAAATCTGAGTTAAAAAGCATC
ATTACTGCTGGCTATTGAATATTTCTACCATAAAACCATT
CGTATAACA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations