header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-488
Transcript Name: six6b-201
Previous Name: six6b-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000005314 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000005314|OTTDARG00000004936|ZDB-GENE-050522-308 six6b|OTTDARP00000004783 six6b-001 LG_ BX649231.4 Danio rerio protein_coding KNOWN, 1615 bp
AGTCCAATAGAAACACAGAAGCGGGCAGCACGTCTTTTCC
CTCCTCAAAAAAATATCTTCATTCTTGTGCTATAATCTCC
TGCCCTCGAACTCTCGGTGTCTCCAACCGAGGCAGCGTCA
GACCGACAGAGCGACATCTCCATTTCTCTGCATCGTCTAA
CATTCATCAGCTGACTCTGGAATTGCCTTTTTGTCTGGAT
TCGGCTGGGGAGCGAGAGAAAAGCCACAGAAAGCACGAAA
CCGTGCTAGAGGTAAACAGGACTGCGAGGGGGAAACAGAA
GCCTTCATGTTTCAGTTGCCAATTTTGAATTTTAGTCCCC
AGCAGGTAGCGGGGGTATGCGAGACTTTGGAAGAGAGCGG
AGACATCGAGCGTCTCGGCCGATTCCTTTGGTCGCTCCCC
GTCGCGCCCGCTGCCTGCGAGGTGCTGAACCGAAATGAGT
CTGTGCTGCGGGCTCGAGCCATCGTAGCCTTCCACACTGG
GAATTTCCGTGAGCTGTACCACATTCTTGAGAACCACAAG
TTCACCAAAGAGTCCCACTCCAAACTGCAAGCACTTTGGC
TGGAGTCACACTACCAGGAGGCAGAGAAGCTCCGAGGCCG
CCCGCTAGGACCAGTGGACAAATACCGGGTACGGAAGAAG
TTCCCCCTGCCTAAAACTATTTGGGATGGAGAACAAAAGA
CGCACTGCTTTAAAGAAAGGACCCGGCATTTACTTCGAGA
ATGGTATCTTCAGGATCCTTATCCGAACCCAAGTAAAAAA
AGAGAGCTTGCACAAGCTACAGGACTCACTCCCACTCAAG
TGGGGAATTGGTTTAAAAATCGAAGACAAAGGGACAGAGC
CGCGGCCGCAAAAAACAGGTTACAACAGCAGGTGTTGTCG
AACGGCTCGGTTCGGTCCTTAAGTGGAGAGGATGGTGCTG
TAGACCGACTGGGGAATGCGTCAAGCCCTGAAGCGAGCCT
GTCCAGCAAAGCCGCTGCGTCGGCGATCTCCATCACTTCA
AGTGACAGCGAATGTGACATCTAACATCGCACCACGAACC
GCCCCGCGGGCTATACGGGAAGACTATGAGAAAATTAACA
CATACGAAGGAAATCGAGACAGACAATCAGCAAGATAAAC
AAGCACATTAGTGCCTGCCTTAACGTATCAGAGGCCGTGT
TTTTGTTTTATTTTCTTTTTTTATTTGGAGGCTGTTACAC
CAGCCGGAATCTTGGGATTCATGGAATGCTTTATCTTTAA
AATGTATTTATGTTTTTGTGAGAGCAAAGTGGGGGAAACA
CGAACAAATGACATCAGAAAAAAAAGATGCTATCTGTATT
AAAACTACTTTTGTAAACAAACTCGGTTGCCTCAAGCAAA
TAGGCTCCCCGACGGAACACTTTTTCTTTTTTATTATTGT
TTTGAAAAGGACTTCATGGTGGTGAAACCGTTTACCTGCA
GGTTTTCTAAGTGTTTACGCATTAAATTGCTCTTATAGAA
TCTGATTTTCAATTGTTTGGTCATTTCAAGTATGGTCATT
TTCGGTGTTGACAGTCGACTTTTAGAGTATGTGCGCCGAT
AGTGAAGATATTAGTGAATGAAAGACTTACCGCTAATAAA
ATGTTGATCAAGTAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
six6b-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000005314 (1),  Ensembl_Trans:ENSDART00000125039 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BG306691 (1) 613 bp
GenBank:BG738558 (1) 510 bp
CITATIONS (2)