Transcript

gabbr2-201

ID
ZDB-TSCRIPT-090929-4813
Name
gabbr2-201
Previous Names
  • gabbr2-001
  • si:dkey-190l1.2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000020593 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000020593|OTTDARG00000017084|ZDB-GENE-060503-620 gabbr2|OTTDARP00000017391 DKEY-190L1.2-001 LG_none BX649545.14,CR933784.6,BX640579.10,BX927195.18,BX649369.6,BX927389.19 Danio rerio protein_coding NOVEL, 2808 bp
ATGGCTCCGTCCCGGAGGGACTGCAGATGTGACATGATCT
TTCTGTCGGGATGCCTACTCTTGTCCGTCTTGGGATTTCA
ACCTGCATTGGCGAAGGTTTGCAACGATTACACAAGGCAC
GGCCTGGACAACAACTGGTACGCGAGGGATGGTGAGAAGT
TGCCTATCATGGTCCTGATGCCGATGAATGAATCAGCGCT
GATGAGCAGCATCAGTCAGGGCATCGAACCGGCCGTTCAG
CTGGCCATTCAGCACATCCGCGAGTCCAGGCAGTACTCCT
TCTCACTCATCACCAAAATCTACGACACAGAGTGTGACAA
TGCAAAGGGATTGCGGGCCTTCTTTGATGCAATCTGCTAC
GGTCCGAAACATTTGATGATCTTTGGAGGAGTGTGTCCAT
CAGTGACTTCAATCATCGCTGAATCGTTGGAAGGGTGGAA
CCTCGTGCAGCTTTCTTTTGCGGCCACTACTCCTGTACTG
GCAGACAGAAAAAAGTATCCAAATTTCTTCAGGACGGTCC
CCTCAGACAACGCTGTGAATCCTGCTGTGGTGAAGTTTCT
CAATTTTTACAACTGGAGCCGGGTGGGAACCCTGACACAG
GACGTCCAACGCTTTTCCGAGGTGCGAAATGATTTGACCA
ATGAGCTGGAGAAGGCAGACATCCAGATTGCAGACACAGA
GAGTTTCTCTAACGATCCCTGTGTGAATGTGAAGAAACTG
AAGGATAATGACGTTCGAATCATCATCGGTCAGTTTGATG
AGAATCTGGCTGCTAAAGTCTTCTGCTGTGCCTACAACCT
TAACATGTATGGCAGCAAGTACCAGTGGATCATCCCGGGA
TGGTACCAGGGGAACTGGTGGGAGCAGGCCAACTCTACAA
ACTGCACCACGAGGAAGCTGCTGACAGCCATGGAGGGCTA
CATCAGTGTGGACTTCGAGCCCCTCAGTGCCAAACAGATT
AAGGGAATATCAGGAAGAACGCCGCAGGAGTATGAGAGGG
AGTACAATCGAGAGCGAGATCAAAAGGGAGTCGAGACCAG
CAAATTCCACGGCTTTGCATATGATGGCATCTGGGTGATC
GCTAAAACACTCACGCGTGTCATGGAGCTCCTGAGACACA
AGGAGAGGCACGACATGTACCACAACTTCACAGTGGACGA
CCGAGAGGTGGGAAAGATGGTCCTCGATGTGATGAATGAA
ACCAACTTCTTTGGAGTGACGGGTCAGGTGATGTTCAGGA
ATGGGGAACGCATGGGAACCATAAAATTCACCCAGTTTCA
AGAGGGTCAGGAGGTGAAGGTGGGCGAGTACAACGCCATT
GCGGATGTACTGGACCTTATCAACAACACCATCAGGTTTC
AAGGTGTCGAACCGCCGAAGGATCGGACATTTGTGCGTCT
GCAGCGTCGGCAAATTAACGTCCCGCTCTACAGCATCTTG
TCTACCATCACGATCCTGGGCATGCTGATGGGTGGCGCTT
TTCTCTTCTTCAACATCAAAAACCGCAACCACAGGCTGAT
CAAAATGTCGAGTCCCTATATGAACAACCTGATCATTCTG
GGTGGCATGCTGTCCTACGCCTCCATCTTCCTCTTCGGGC
TGGACGGATCTTTTGTGTCAGACAAGGAGTTTGAAACCCT
CTGCACTGTCCGTACATGGATCCTCATTGTGGGGTACACA
ACAGCGTTTGGTGCCATGTTTGCGAAGACCTGGAGAGTCC
ATGCCATCTTCAAGAATGTAAAGATGAAGAAGAAGATTAT
CAAGGACCAGAAGCTCTTTATCATCGTGGGAGGGATGTTG
CTGATTGATTTGTGCATCCTCATATGCTGGCAGATCGTGG
ATCCCCTGAAGAGAACTGTGGAAGAGTACAGCTTGGAGGC
GGATCCTCAGGGACGAGACATCGCAATCCGGCCTTTCCTG
GAGCACTGCGAGAACACACACATGACCATTTGGCTGGGAA
TTGTCTATGCCTACAAAGGCCTCCTTATGTTGTTCGGATG
TTTCTTGGCCTGGGAGACGAGAAACGTGAGCATCCCAGCA
CTGAACGACAGCAAGTACATCGGTATGAGTGTGTACAATG
TGGGCATCATGTGCATCATCGGGGCAGCGGTGTCCTTCCT
GACTCGGGATCAGCCTAATGTTCAGTTCTGCATTGTGGCC
CTGGTCATCATTTTCTGCAGCACCATCACGCTGTGTCTGG
TATTTGTGCCAAAATTTGTTACAATGCGAACAAACCCGGA
TGCTGCTACACAAAACCGGAGGTTGAAGTTCACCCAGAAC
CAGAAGAAGGAAGATTCCAAGACATCCACCTCAGTGACCA
GTGTTAACCAAGCCAACACTTCACGTCTGGATGGACTACA
GTCAGACAATCATCGCCTTCGAATGAAAATTACAGAGCTG
GATAAAGAACTGGAAGAGGTTACCATGCAACTCCAGGACA
CTCCAGAAAAGACTCCATACATTAAACAAAACCACTACCA
AGATGCCAACAATATCCTGAGCATACGCAACTTCACTGAC
GGCAAAGATGGAGAGAAGTCTCTGAAGAACCACCTAGAGC
AGAAACCCCAGGCTCAGTGGGGATCCGCGGATCCTTCTAG
GATAAGTAGAGGTCCACTAGAAGACATCAACTCACCAGAA
CACATACAGCGCCGGCTATCCTTGCAGCTGCCAATCCTGC
ATCATGCCTATCTACCCTCCATAGGAGGTGTGGACGCAAG
TTGCAGCAGTCCCACAAGCAGCCCATCCTCCAGTCCCCGC
CACAGACACATGCCTCCCTCCTACAGGGTCATGGTGTCCG
GCCTGTGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations