Transcript

csmd2-201

ID
ZDB-TSCRIPT-090929-4812
Name
csmd2-201
Previous Names
  • si:ch211-46o5.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000020590 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000020590|OTTDARG00000017081|ZDB-GENE-060503-890 si:ch211-46o5.1|OTTDARP00000017388 CH211-46O5.1-001 LG_none CR936278.9,AL732499.6,BX511094.6,BX469885.9,FP016008.8,FP085409.3 Danio rerio protein_coding NOVEL, 12344 bp
TAGAGCTTGCATAGCGGTCGCGCTCCTCGTTTCATTTGCT
TAAATCTTGAAACAGAGCGCCCAGCCAGATGTGGAAACCC
CTTAACGATTATTTTCACGGCTGGAAATGATTCAGACAGC
GAGAAAGGCTGTAAACTTCCACGAGTGGGCGGTGATACCG
AGTGAATCCTAGCGGTTCTTGCACAGTGACTCATTTGGAG
AAAGACACAAACGTGGATTTCAGCGCTGCGTTAATTGGGA
ATTAAACTTAAAGTCGCGCGCAGTGGAGGCGTACGCATAT
AGGCGGATGCCGCATCATCCATCCGAGTCGCTTTCCAGAC
TTTACCCGTTCACGTCAGCTTGAAGAGATCAGATACAGTT
CTCCTTATCAGCTCTTCAGGTTTTAGGAGAGAACGCGTCT
ATTAGAATCGGCTCACCCCGCGGCTCGCTTGAGATGGTTC
AGTCCAGCTGCGAGGGTCCAGTCTCCATGCACTGGGATTT
TTCTCAGCGCCGACACCAAGTGAATCTTCCTTTTAAAACC
ATCTGATAACCGTGCCTGCCAAAAAAGCCCACCATGAGCG
CCTCTTTGAATCCTGACAGAACGGGACTCGTGAGGACAGA
GTGCAGATGTACATATAACGGGACAAGGAAACTGGATGGT
ATAAGGATTTTTGCGCTAATGAAGGTGGGAGTACAGGCGC
ATCACTGGAGCGGGGTGCTGTTCTTCTATATGGGGCTGCT
GGCTGCATCGGTGAAGGCTCAAAACTGCAGTCACACGCTA
CACAGTCCAAATGGGACAATAGAAAGCCCCGGATACCCGT
ATGGATATCCCAACTACGCCAACTGCACATGGGTGATTGT
GGCACAGGAACACAACCGGATACAGTTGGTATTTCAAGGC
TTTGCCTTAGAGGAGGACTTTGACATCCTTTCAGTCTACG
ATGGGCAACCCAGTCCCACAAACTTACGGACACGGTTGAC
GGGGTTTCAACTTCCAGCCCCTATAGTGAGCACAGGCCCC
AGACTCACATTATGGTTGCTGTCAGACTATGCCGTAAGTG
GCCAGGGATTCAAAGCCGTGTACGAAGCTCTTCCAAGCTA
CACATGTGGAAATCCAGGCCAGCTGCTCAACGGCATGCAG
CAGGGATCCACCTTCAACATCGGGGACAAGATCCGCTACA
GCTGCAACCAGGGATATGTTCTGGAGGGCCACACCGTGCT
CTCCTGCCTGGCCACATCATCCGGCACCGCTGCCTGGGAC
TTCCCTCTGCCCTACTGCCGAGCGGATGATGGTTGTGGTG
GCACTTTACGGGGTCAAAGCGGTGTTATTACCAGTCCAAA
TTACCCCCAGGAGTACAACAACAACGCAGACTGCACCTGG
ACCATCCTAGCCGAACCAGGAGACACCATCGCTCTGGTCT
TCTCCGACTTTCAATTGGAAGAAGACTATGATGTACTGGA
GATAACCGGCACAGAAGGATCATCTCAGTGGTTTACTGGT
CCAAACCTGCCATCTCCCATCATCAGCAGCAAGAACTGGC
TGAGACTCCACTTCACATCAGATGGAAACCACAAACTGAG
AGGCTTCAGTGCTCAGTATCAAGTGAAGAAGATGACAGAG
CTGAAGTCCAGAGGGGTGAAGATGCTGCCAAGTAAAGACA
ACCACAGCAAGATATCAGTTTTGTCGCAGATGGGGGTGGC
GCAAGGACACAACATGTGCCCAGATCCAGGAATCCCGGAG
AGGGGCAAAAGAAAAGGCTCTGATTTCAGACGGGGTGCTA
CTGTGCACTTTTCTTGTGATGAAGGATATGAGCTTCAGGG
GTCTAAAAGCATCACCTGTTTGCGAGTTACAGACAGTTAT
GTTGGATGGAGTGATGACCGGCCGATCTGCAGAGCTCCCA
TGTGTGGTGGTCAGCTCCGTGGCCCGAGTGGGATCATCAC
CTCCCCAAACTTTCCAGTACAATATGACAACAATGCAAAC
TGTACCTGGATCATCACCGCTTCAGACTCCTCCAAGGTGA
TCAAGCTGACATTCGAGGAGTTTGACCTGGAGCGAGGCTA
CGACACGCTAACTGTTGGAGACGGCTCTGTAATCGGCGAT
CAGCGGACGGTCTTTCATGTGCTGTCTGGGACTACGACTC
CGGATCTGGTGGTCAGCACTAGTCATCAGATGTGGCTTAA
TTTTAAAACGGATGATACAAGTGGCTCCCTGGGCTTTAAG
GTTTCTTATGAAGAAATTGACCAGGGCGGCTGCGGAGACC
CTGGAATCCCAGCCTACGGCAAGAGGGAAGGCACAGGCTT
CCGACACGGAGACAAGCTATATTTTGAGTGTCTTCCAGCC
TTTGAGCTTGTTGGAAAAAAGAACATTACCTGCCAGAAAA
ATAATCAGTGGTCGGCCAAGAAGCCAAGCTGCGTGTTTTC
ATGTTTCTTCAACTTCACGACTCCGTCTGGGGTTCTGCTA
TCACCAAACTACCCTCAAGAGTACGGCAACAACATGCACT
GCGTGTGGCTGATCATCGCCAAACCAGAGAGCAGAATCAA
CCTGGCCTTCAATGACCTGAGCATGGAGAAACAGTTTGAC
TTCTTGTCCATTAAAGATGGCGGAAAAGCAGAGTCGCCTA
TTTTGGGCACCTTTTCTGGAGACGTGCTGCCATCACCCAT
TACTACCAGCGGTCACGTGGCACGATTGGAGTTTTTGACG
GACCACACATACACAGATCGGGGATTCAACATCACTTTCA
CCACATTTCGACACAATGAATGTCCCGACCCCGGTGTTCC
AGTAAACGGAAAGCGCTTTGGTGAAAGTCTTCAGCTTGGC
AGCTCCATCTCGTTCCTGTGCGAGGAGGGCTTCACGAAAA
CCCACGGCTCTCAGACCATCTCCTGCATCCTCAAAGATGG
AAACGTTGTGTGGGATAATGCCGTTCCACGCTGCGAAGCT
CCATGTGGTGGAAACCTGAAGGCTTCCAGCGGCATCATTC
TGTCCCCAGGCTGGCCTGAGCTTTATAAAGAGGCTCTGAA
TTGTGAGTGGATCATCGAGGCTCTGCCAGGATATCCTATT
AAGATCATCTTTGACAAGTTTCGTACAGAGGTGAACTATG
ATGTTCTAGAGGTTCGGGACGGCCGTTATCCTTCTTCGCC
TCTGATTGGCAGTTATCAGGGCACACAGGTCCCACAGTTC
CTCATCAGCACCTCTAACTTCCTCTACCTGCTCTTCACCA
CTGACAAGAGCCATTCCGACATCGGCTTTCGTATTCGATA
TGAGACTCTGCAGCTTCAGTCGGACCACTGTGTTGATCCA
GGAATCCCAGTCAATGGTCAGCGACACGGCAATGATTTCT
ACGTGGGAGCGCTGGTGACATTTAGCTGTGAAGCCGGATA
CACTCTCAGTGACCACGAGCCCCTCGAATGTGAACCAAAC
TTCCAGTGGAGTCGCCCCCTGCCCAGCTGCGATGCGCTCT
GTGGAGGGTTTATTCAGGGGAACAGCGGCACTATTCTGTC
CCCTGGGTTTCCAGATTTCTACCCACATAACCTCAACTGC
ACCTGGATGATTGAGACTTCACATGGGAAAGGAGTCCAGT
TTACCTTCCACACCTTTCACTTGGAGAGTCCTCACGACCA
CCTTTTAGTTACAGAAAATGGTAGTTTTTCTCAACCCCTG
TGGAGATTGACCGGCTCGACACTTCCTCCTCCTCTTAGCG
CTGGACTCTTCGGCAACTACACCGCTCAGATCCGCTTCCT
CTCTGACTTCTCTGTTTCCTACGAGGGCTTTAATATCACT
TTTTCAGAATATGACCTGGAGCCTTGCGAGGATCCTGGGA
TCCCCCCCTTCAGCACTCGTAAGGGTCTGCAGTTTGGGGT
TGGGGATGCGCTCATCTTCTCCTGTTTTCCGGGGTATCGT
CTTGAGGGGCCTGCGAGGGTGGTGTGTTTAGGGGGGCGTC
GGAGGGTCTGGAGTTCCCCTCTGCCAAGGTGTGTTGCTGA
ATGTGGATCATCTGTAACTGGAAAACAAGGTGTTTTACTC
TCTCCTAATTACCCTGGTTACTATGGTAATGACCATGAGT
GCATCTACTCCATTCAAACTCAACCTGGTAAAGGGATCCA
GCTCAGAGCTCGTGATTTCCACCTGGAGGAAGACGACATG
CTTAAGGTATATGATGGCAACAGCAACAGTGCCCGACTGC
TGGGCACCTTCACGGGCACAGAGCTGATGGATGTCACTCT
GAACAGCACGTCCAGCTCCATGTGGCTTGAGTTCATTAGC
AACAGTGAGAACACCAGCAAAGGGTTTGAGCTGCACTTCA
CCAGTTTTGAATTGGTGAAGTGTGAGGACCCAGGTGTGCC
TCAGTTCGGTTTTAAACGGGAGGATAAAGGTCACTTTGCA
GGCAGCACGGTGTCTTATAGCTGCGATCCAGGCTACAGTT
TAAAGGGCCCAGAGGTTTTGACATGTCTCAGAGGGGAAAG
ACGAGCTTGGGACAGTCCTCTCCCACAGTGTGTGGCCGAG
TGTGGAGGGAAAATTAAAGACGAGTCTATGGGCCGGATTC
TGTCTCCTGGTTACCCAGCGCCTTATGAGCACAACTTGCA
CTGTGTCTGGACCATTGAGGCGGCACTTGGAAGCACCATC
GGGTTGCATTTCCTGGTCTTCCACACAGAAGAGGTGCATG
ATGTTCTGCGCATCTGGGATGGGCCTCAGGACGGAGGTGT
GCTTTTGAGAGAACTGAGTGGATCCACTCTTCCTCCAGAC
CTCCACAGCACCTTTAATTCTGTCAGTCTGCAGTTTACAA
CCGACTTCTTCACCAGCAAGCAGGGATTTGCTCTGCAGTT
CTCAGCTACTTCCTGTAACGATCCTGGCATTCCAACAAAC
GGCACTCGAATAGGAGACAGCAGAGAGCCAGGGGATCATG
TGCTGTTCCAGTGTGATCCCGGATACCTCCTACAGGGGGC
AACCAAGATCACCTGCACAGAGATCAACAACCGCTTCTTC
TGGCAGCCTGATCCGCCCACCTGTTCTGCTCCATGTGGAG
GGAATCTGACAGGTCCCAGTGGGCTGATCCTGTCTCCCGA
ATACCCAGAGCCATATCCACACGGCAGAGAATGTGACTGG
ACAGTAACAGTGACGCTGGACCACATCATATCTCTCAATT
TTAATCACTTTAGCCTGGAGCCGAGCTATGACTTCCTGCA
CATCTATGATGGTCCTGATTCTCTCAGTCCACTGCTGGGC
AGCTTCTATGGCACAGATGTCCCTGATCGCATTGAGAGCA
GCTCAAACACACTCTTCCTGGCCTTCCGCAGCGATGCTTC
ACTCAGCAGCAATGGATTTGTCCTACAGTACACTGAAAAT
CCCAGAGAGTCTTGCTTTGAGCCCGGCTTGGTTCGTAATG
GCACTCGTGTTGGTACTGAGCTGAAGCTGGGGGCAACTGT
CACTTATTACTGTGACAGTGGCTACACGCTGGAGGGAGAC
GCCACTCTCACTTGTATCATGGGGTCTGACGGCAAACCTG
GCTGGAACAAACCAAAACCTGTTTGCATAGCACCGTGCGG
TGGTCAGTATTCCGGGCTGGAGGGGGTTGTGCTTTCCCCT
GGTTATCCTGGAAACTACAGCAGTGGGAGGACTTGCCTGT
ACTCAGTTGTTGTGCCGAGAGACTATGTGGTGTTCAGCCA
ATTTGCATTCTTCCAGACGGCTCTAAATGATGTTGTGGAG
GTGTATGATGGACCGACACAGCATGCCCGTGTCCTGAGTT
CTCTCTCTGGAGCCCACACAGGTGAATCTTTGCCGTTAGC
CACCTCCAACCAGATCCTCATCCGCTTCACCTCTAAGGGT
CAGTCCAGCTCAAGAGGTTTCCATCTGGTCTACCAAGCTG
TCCCAAGGACCAGTGCGACCCAATGCAGCTCAGTCCCAGA
GCCCAGGCACGGCAGGCGCACAGGGAATAACTTTGCGGTG
GGAGCCGTGGTGAGTTTCGAATGCAATGCTGGGTACGTCC
TGGAGGGGCCGAGTGCTATTGAGTGCCTGACTGTACCCAA
CGCTCTGGCCCAGTGGAATGGCAGCATGCCCAGCTGCATT
GTGCCGTGTGGAGGGAATCTTACCCAGCGGATAGGCACTA
TTCTGTCTCCTGGCTATCCTGAGCCCTACCTGAACAGCTT
GAGCTGTGTGTGGAAGATCACCGTGCCTGAGGGAATGGGA
ATTCAGATCCAGGTGATTAGCTTTGTGACTGAGCAGAACT
GGGACTCTCTCGAGGTGTTTGATGGAGGTACAACAGTGCC
AGCCCTTCTGAACAGCACCTCCAACCAGCTCTACCTGCAC
TTCTTCTCAGACATCAGCGTCTCTGCAGCCGGTTTCCGTC
TGGAGTACAAGACTGTGTCCCTCACTAGTTGTCCTGAACC
GGTTGTACCCATGAATGGCTTCAGAGTGGGCGAAAGACTA
CAGATGAACAATGTTGTGTCCTTTCAGTGCGACCCTGGAT
TTACGCTGCAGGGAGTCTCCCATATCTCCTGCATGCCAGG
GCCTGTGCGCCGCTGGAACTATCCGCCTCCTCTCTGCATC
GCTCAGTGTGGAGGGATCAGAGAGGAGATGGAAGGCACCA
TCCTCAGCCCTGGTTTCCCAGGAAACTACCCTAGCAACGG
CGACTGCACCTGGAGGATTTACTTGCCAGTCGGTTACGGG
GCTCATGTGCAGTTTTTGAACTTTTCCACCGAGGCCAACC
ATGATTTCCTGGAAATAAGGAACGGACCTTTTGACACTAG
CACAGTGATTGGCAGGTTCAGCGGACAGGAATTACCATCA
TCTCTCCTAACCACTTCCCACGAGACCACAGTATACTTCC
ACAGCGACCACTCTCAGAATAAACCTGGCTTCAGATTTGA
TTATCAGGCATATGAACTCCAGGAGTGTCCTGATCCTGAA
CCCTTCCATAATGGTGTGGTGGTTGGTGCTGGTTATAACG
TGGGTCAGTCCATCTCCTTCGAGTGCTATCCAGGGTATCA
TCTGACAGGACACTCCATTCTTACCTGTCAACACGGCACG
ACGCGCAACTGGGATCATCCGTTTCCTCGCTGTGAAGTGC
CCTGTGGAGGTAACATTACATCAGACAATGGCACAATCTT
CTCTCCCGGTTACCCAGAGGACTATCCCACATCTGCGGAT
TGCAGCTGGCTGATTACGGTGGCACCAGGCCTGGGTATCC
GTCTTAATTTCACCCTTCTGCAAGTCCACGGCCCTCAAGA
TTTCATCACAGTTTGGGATGGACCACAGGAAACAACTCGT
AAACTTGGAGTGTTTACCGAGGGAGAGCCAAACAACCCAC
CGAGCAGCACATCTAATCAAGTTCTGATACGTTTCCGAAG
CAGTTCTGAGAAAGGGGGGTTGTTCAAGATCAACTACCAA
GCCTATAGACTACAGTTTTGCTTGCCACCTCCCATCATTC
CTAATGCAGAAATTCTGATGGCCAGTAAAGAATTCAAGAT
TGGTGATATTGTGCGTTACAGATGTTTGCCAGGATATCAT
CTTAATGGAAACAGCATTCAAACCTGTCGCCTCGGGACGC
ATCTCGAGTTTGATGGACCTCCACCTTCCTGTGATATTAC
CTGTCCCATGAACGAGGTGCTGACGGCCTCTACAGGGGTG
ATCCTTAGTCAGTCTCCGGGCAGCAGCCTGCCACACTTTG
AGTCCTGCTCCTGGTTGGTGAAGGTGGATTCGGGCTACAA
CATCACTTTCACTGTTGAACATTTTCAGACCAGCAGGCAG
TTTGATGAGCTGGAAATATTTGATGGTCCGTCAAGACAGA
GTCCACTGCTCATTTCTCTGAGTGGGAATTATTCTTCTCC
TCTCAGCATTACTAGCTCTGCAAACAAGGTTTACCTGCAC
TGGTCCTTTGATCACACCTCCAGCCACAAGGGCTTTCGAA
TCCGCTACTCAGCGGCCTACTGCAGTTCTCCAGATCCTCC
TGTCAATGGCTCGCTGCACAGCCAGACTGGTACGAAATTG
GGCAGCACTTTGCGCTTCAACTGTGACCGAGGCTTCAACC
TGATCGGCCAAACCACAGCCACCTGCTACCGCACCCCGCA
GGGCATCTACCAATGGAACGCTCCAGTGCCACTTTGCCAA
GTCGTTTCCTGTGGGATGCCGATTGCTCCAGTCAATGGCA
CTGTCATCGGGCAGCACTTCACTCTCGGATCTAGAGTCAC
TTTCTCTTGTAATCCTGGTTTCCGATTGGCCAACACTCAG
CCAGTGTCAACACTTTGTCAAGAGTCTGGGAGGTGGAGCC
CAATCGAGACCCGCCCTCGCTGCGTCCCTGTGAACTGCCC
TGACATCGGCCACTCTGCAGTAGATCATGGGAGGTGGAGG
CTTATTTATGGCATGCAGAATAAATATGAAGCTATGATGA
TGCTGACCTGTGACCCTGGATATTTCTACAAGGGTCAAAG
GGTCATCCGCTGCCAAGCTAATGGCACCTGGGATTACCCT
GAGCCAAGACCTTCCTGTGAAATAATTTCCTGCGGTGACC
TTGGAACCCCTCCGAATGGGAATAAAATTGGAACATTAAC
TGTGTATGGAGCGACTGCCATTTTTTCCTGTAATACGGGT
TATACTCTAGTGGGCTCCAGAGTGAGAGAGTGTATGTCCA
ATGGCCTGTGGAGTGGAGCTGAGGTCCAGTGTCTTGCTGG
ACACTGTGGCACACCAGAGCCTATAGTGAATGGTCAGATC
ATTGGAGAAAACTACAACTACAGAGGCAGTGTTGTTTACC
AGTGTAATCCTGGATTCCGGCTCATCGGCGTGTCCGTTCG
CATCTGTGAGCAGGACCACCGCTGGTCCGGGAAGACTCCT
GTCTGTATCCCCATCACATGTGGACATCCAGGCACTCCTG
CTAATGGTGTGACGCAAGGAACACAGTTTAACCTAAATGA
TATTGTGCGTTTCGCATGCAACCCTGGTTACGTTCTACAA
GGTGCGCTCAAGTCTCAATGTCAATCCAACGGCCAATGGA
GCAACGCTCTTCCCAGGTGTAAAATTGTGAACTGCACTGA
TCCGGGACATGTTGAAAATGGTGTCAGACAGGTCCTGCCC
AGCGGGCCTCATCGTTACAGTTTCCAGACCGCAGTTTCTT
ACAACTGTAACCCTGGGTACTACCTGCTGGGCAGCAGCAT
TTTGAGCTGTCAAGGAGACGGGACATGGGACCGTTCCCTT
CCCAAGTGCCTATTGGTTCTGTGTGATCGTCCCAGCATGC
CTCCGTATGCACAGATCTCAGGGGACAGGCGCACAGTGGG
CTCCGTTATCCGCTTCAGCTGCATCGGCCAGCGCAGCATT
GTGGGCAATACCACCCGCATGTGCCAGCTGGATGGCCAGT
GGAGCGGCTCCCTGCCACATTGCTCTGGGGATTCTGCTGG
TCTGTGTGGAGATCCAGGCATTCCAGTACATGGGATCCGT
CTGGGAGAAGAGTTCACCACAGGGAGTGTTGTCCGATTCA
GCTGCGAGCCTGGATACCAGCTGAAGGGCTCCTCCGAGCG
GACCTGTCTGGCTAACGGGAGCTGGGTGGGCATCCAGCCT
GAATGCCACGTGGTCTCATGTGGCAACCCTGGCACTCCCC
GAAATGCCATGATTCAGTTTCATGACGGACTGGTGTTTTC
CCGCTCCATCACCTACTCCTGCAGAGAGGGTTATTACTCT
ACTGGTCTGCTCACCCGCCACTGTACTGTCAACGGCACCT
GGACCGGAGACATGCCCGAATGCACAGTCATTAACTGTGG
TGATCCTGGAGTGCCGGCTAATGGGATCAGACTGGGCAGT
GACTTCACGTACAGCCACAGTGTGAGCTTCCAGTGTTCAC
CGGGATTCACTATGGATGCTGATCGGGCTTCCACACTCAT
CTGCACCAAGGACCGAACGTGGAATGGCACAAAGCCAGTT
TGCAAAGCCATTGTGTGTGCAGCACCTCCCAGCATCCCGA
ATGGTCAGGTAGTGGGATCTGACTTCCAGTGGGGATCCAG
CATTAGTTATAGCTGTAATCAGGGTTACCAGCTCTCCCTT
CCCACCATCCTCACCTGCCAGGGCAGTGGAAACTGGAGCG
GCGAACGACCTCAGTGTTTCCCTGTATTTTGTGGAGATCC
AGGGATTCCAGCCCAGGGGAAGAGGGAGGACAGAGGGTTT
ACCTACCTGTCCTCTGTTTCATTCTCCTGTTACCCGCCTT
TGATTTTAGTTGGCTCTGCTCGACGATACTGCCAGTATGA
TGGAACCTGGAGTGGAACCCAGCCTTCTTGCATAGATCCC
AGTCACACCAGCTGTGTGGATCCTGGCACTCCTCTCTTCG
GCCACCAGAACAACTCTCAAGGCTACCAGATTGGTAGTTC
AGTGTACTACAGCTGCAGGAAGGGTCATCTTCTTCTGGGT
TCAATCTCACGGACGTGTCTACCAAACCTCACCTGGAGCG
GCATGCAGCCTGAGTGCATAGCTCATCACTGTAATCAGCC
AGAGCTGCCTGCTCAGGCAGATGTAGGTGCCATAGAGCTG
CCGTCTCTGGGTTATACTCTCATCTACACCTGTCAGCCTG
GTTTTTACCTCGCTGGAGGCTCTGAACATCGAACCTGCAG
GGCTGATGGCAGCTGGACAGGGAAACCTCCACTGTGTGCA
CCTGATAACAGACCAAGTGGAAAAACCGTAGGAACAGTGC
AAGAGCCACCCAACACAAAGCAACCGGTGCCAAGTGGGGT
TTTTGCGAAGAACTCTCTCTGGAGGGGTTCATACGAATAT
CTAGGGAAGAAGCAGCCAGCAATGCTTAGCATAACTGCGT
TTGAAGCGTTCAGCAATCGGGTCAATGGCACTCTCATGGA
CCACAGCGGAGTTCAGCTCAATCTGGCTGGTATCTTTAAG
AAAGAAGAAGCCCAGTTGCTGCTGCAGGTGTATCAGATTC
GTGGCCCTGTGGAGATCTTCGTTAACAAGTTCAAAATTGA
CAACTGGGCACTTGATGGACATGTGTCATACATGCCTTCA
TCTGATTCATTCGTATACCAGGGCTTTGTTCGAGGAAAGG
GTTTTGGCCAGTTTGGACTTCAGAGGCTGGAAGGCCTTGA
TCCGAATGGGGAGAATCCAGGCTATAACTTTGCCTCCAAT
AGCAGTTCAGTGGCAGCCGCCATTTTAGTGCCTTTCATTG
CCATGATCATAGCAGGCTTTGCTCTCTATCTCTACAAACA
CAGAAAAAGACCTAAAGTCCCCTTTAATGGTTATGCGGGC
CATGAGAACACCAATGGAAGGGCGACTTTCGAGAACCCAA
TGTATGACCGCAACATCCAGCCCACTGACATCATGGCCAA
CGAGACAGAGTTCACGGTCAGCACAGTGTGTACTGCAGTA
TAGCGACCGCTCTAGTCAAAGGCTGGATGTAATCTTTCCA
TCTCCACACAACTGTTCCCATAGTTACAAATGGGTCACTT
GGATGGACGAAAGACGAGGAGATATATTTTGATTTGTTTT
TCATTTGTAAACCAATTCCAATCGTGACAAACAGTGAAAA
TCCTTAACAACGATGCTGAAAAAGTGCATCGACAGACACA
CTGATCAGTGTTTGCTAGCTAAAACTCTGTTTCTACACTC
TTCTGCTGTCTCCTCTTTTTTTCCTTCTGAGGAAACGTCC
TGTTTGACTGCGGTAAAAGAGACACATGCGAAACTTGCTT
GCCAAAAAAAAAAAAAAAAGACAAGACAAGAGAAACATTA
TCCGGTCAAACTAATTCTGTCCATTCTAAACTCTAGAAGT
GGAGGAGTTCTTCACGTGAGCTGGAAGTTAAAGAGAAGCA
CGTTGCTGGAGAGTCGAAACTTTGTTTTACTTTTATACTT
TCAGTTCTTTTCACGGATCCCATTTTGTCTGGTTTTATCT
CCTTGAACTGAAATCACATTGCAGACTTCGCTGAGGACAC
ACGTTGGTTCCCTGACGCCACAATTGAAGTGGAATGAGAT
TCGGAGGCTTATTAGAAGACATGGATTCTAGCTGTAGCAC
CTCTTTTCTCATTCCAGCCCGAAGGGAACGGTGGTGATTT
GCCACCATCTTATCATGATCCCGACTGAGAACGGACAGTC
TGACCCTTCGAGAAGCCCAGCGGAAAGAGCATGAAAAGAC
ACGTCGCACGTGTTTTTTGTGCTCTGAGGCTTTATGAAGC
TGACTTCATGGCCGTTATTTCCTACCATTGAAGGGTTGGA
TTTTATCTGAATTTCCCAGGAGGGCCGTCGGAAATTTCTC
CATCTCAAAGTTGAGATGTTCTTGATTTGTGGGCTTTGGT
ATCATGAGGAGGAGCCGCTTGTTAGCATTTACTAATATTC
CTGATGTCAGACAGGTTTCAGGTGGGCTTCTGAATGTCAC
GAATCAACCATGTAGAGATTTCTT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations