Transcript

ndufv1-003

ID
ZDB-TSCRIPT-090929-4801
Name
ndufv1-003
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000020568 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000020568|OTTDARG00000017060|ZDB-GENE-040808-73 ndufv1|no_translation ndufv1-003 LG_ CR391915.9 Danio rerio protein_coding KNOWN, 1310 bp
TTCCGCTGTCATTTTTATAACGCTGATCCAGGGAGATCAC
GAAGATAAGGATGTTGTCGTGTCTCGGCTCTCCAGCTCTT
AGCCGGGTTCTGAGCAGCGGGGCGTCTCGTGCTCCTGTGG
CAGTGGCTGTAGCTGGAGCCTCTCGCACCTCTGTGTCCTC
CAACTCTGCTCCACAATGCAGGACTCTGCTCCGCTACAGC
AGCACAGCTCAACAGGAAACACCCAAGAAGACCAAGTTTG
GGCCTCTTGCTGACCAGGACAGAATATTCACTAACCTGTA
TGGACGCCATGACTGGAGGCTGAAGGGTGCCCTGAGGAGA
GGCGACTGGTACAAGACCAAGGAGATTCTGGATAAAGGAG
TGGACTGGATCCTGAATGAGATTAAGACCTCCGGGCTGCG
GGGCCGAGGTGGTGCTGGATTCCCAACAGGGATGAAGTGG
AGCTTCATGAACAAGCCCAGTGATGGCAGGCCTAAATATC
TGGTGGTGAATGCTGACGAAGGAGAGCCTGGGACCTGTAA
GGACAGAGAGATCATGCGTAATGATCCGCACAAGCTAATC
GAGGGCTGTCTGGTCGCCGGCAGGGCCATGGGCGCTCGAG
CTGCCTACATCTACATCCGCGGAGAGTTTTACAATGAGTC
CTCCAACCTGCAGGTCAGGAGGCTGAAAACGAGCCCAGAA
GAAAATAAGATCTTCATTTATTTATTCATTTATTTTCATC
TTCAGTACCATGAGTATTGCTGCATCCTTTATGACAGTTT
TATTAAACATGTACATTCATTAAAATATTTACTTCAGATA
TTCGAAATAAGAAAAATAATGCTTTTAAATTGTGACAGAT
AGCCGACATCGAAGGCTGAGAGCCGATATATCGGCCGATA
AGTATATTATATTTTTCGATTTTTCTGCATCATTGCAAAC
ACATGAGGTAAACAACTGATTTTATTTTAGAAGCTCAGTA
ATGTTTGAACTGATGTTTGAAATTTATTAATCATCTATTC
ATATCTATGGCCGACTTAAAAAAACATTAATAAAGGAATA
ACACATTAACCAAAATAAAATAATCAGTAAAACACTAAAG
CAGTGGTGGGCAGAAAGCGCTTGAAGTGGTTCAACCAGTA
GAAAAATACTTTAAATTATTTATTACTTAAAGATATCGGC
CTAATTTGTTATTGGAGTGACGATAACATTAAAAATGGCA
TTTATAGGCCGATATTGTTAAAGTTGTCCAAATATTGTGG
ATTCTTAATGAATTAAATGCTGGTGTTACAAAAACAGCAA
GACCCTACAATAAATTCAGCCAAACCTCCG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations