Transcript

pln-003

ID
ZDB-TSCRIPT-090929-4715
Name
pln-003
Previous Names
None
Transcript Type
antisense
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000020302 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000020302|OTTDARG00000016851|ZDB-GENE-060503-603 pln|no_translation CH211-260O22.1-003 LG_none AL845301.15,CR926459.7 Danio rerio antisense NOVEL, 674 bp
AAAACCACAGCAGCGCCACCCAACACCAAACACTGTCCAT
CTACAACTTCAGCTCTTTCCACGGCATGTGAGAGGCCGAC
GGCGTGATGTAACCAGCTTCTCATCGAAAGACAAGAAGAC
CATCCACCTGAAGCTAAACACACTTGTCCTGCACATCATC
CTGACCTGAACCTGATTAAATCTCCAGCCGTCAGTATGGA
TCTGATCAATAACCGAGGACTAAATCTGCTGCTCAACTTC
CTGCTCATTTTTGTGGCTCTACTGCTCATGCTTATTCTGG
TCAAGCTCATGTGACCAAAAAAAAATGGTTACAAGTAACA
ATGTACAATATATCGGTGGCCATAATGATATCAGCCAATA
ATGCTATTTTTTTATCGTTATCGTTCTGATAACATTATTA
GGCTGATCTTAAGCCGAGAAATGATGTATTATTTCTGCTG
GTTGAACCACTTCACGAGATTGCTGCTTGACACTTTTTTA
TTCATTTGATCACATTTAAATTGACACTTTTATATTTATT
TTTTATTTTACTTGGTTTTGGTGACCATAAGGATATCGGC
CAATAATGATATTTTTTATGTTATCGTTCTGATAACATTA
TTAGGCTGATCTTTAAGCCGATAAATGATGTATTATTTCT
GCTGGTGGAACCACTTCACGTGCTTGCTGCTTGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations