ZFIN ID: ZDB-TSCRIPT-090929-4714
Transcript Name: pln-002
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: antisense
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000020301 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000020301|OTTDARG00000016851|ZDB-GENE-060503-603 pln|no_translation CH211-260O22.1-002 LG_none AL845301.15,CR926459.7 Danio rerio antisense NOVEL, 882 bp
TACTGCCATAAACTTTCAGCACTCCAGAGCACTGCCACAG
ATCTAGAAGAAAACCACAGCAGCGCCACCCAACACCAAAC
ACTGTCCATCTACAACTTCAGCCTCCACGTGGTCCACCGG
CATCCGGATCACCTCTTCCATCACCACAACATCCAGCACT
CCTTTCTCCACTGCCATCTCTCCTTCTTCTCCTCTCTCTC
TATGCACTAATCCATTCATCCCACCCACCCACAAGCCCCA
CGGCTCGCTATGGAGAAGGTGCAGCACATGACACGGGCGG
CCATTCGGCGGGCGTCCACCATGGAGGTTCCCCAACAGGC
CAAGCAGAACATGCAGGAGCTCTTCGTCAACTTCTGCCTC
ATCCTCATCTGCCTGCTGCTCATCTACATCATTGTGTTGC
TAATGTGAGCGGGTTGGGTCTCCCTCTAGCCAATGAGAGC
GAAGGACTGTACATTGGGGGCCAATCGCGGCGTTAAGGGG
AGTGGGGGGTTATTATTTATAAAGGGTTTAGAGTAGTTGG
GTTCTACAATGCATTATTTGTTTGTAAATAGTACACATTT
AGAGGTTAGGAGGGTAGGGATAATAATAGGCATTAATTAT
TGGTGTGTTGGAGGATTTTAAGTGGATAAAAGATCTGGCT
CATGAAATGCAAATATATGTGATATATGAGTAACATAATT
TAAATCTGTAATTTAATAAAATTATGGGCCAAATATTAAG
GCAGAATTACATGAATACTTTGAAAAAAGATGGTGAATAA
GGGGAAAACAATGAGAAGTGCATACTTTCGGAGTGTAATT
AAACATTTAAATCATTACCGAAAAACAGAAAAAATGTTAC
TCTATCCTTCAGAGATTTGGGCTCAGTAAGTTTTTTTTAT
TT

pln TRANSCRIPTS
Type Name Length (nt) Analysis
antisense pln-001 (1)    Ensembl 2595
pln-002 882
pln-003 (1)    Ensembl 674
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
pln-002 Contained in:

Genome Resources: Vega_Trans:OTTDART00000020301 (1),  Ensembl_Trans:ENSDART00000133911 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CN178750 (1) 909 nt
GenBank:CN017727 (1) 894 nt
GenBank:CO921740 (1) 758 nt
CITATIONS (2)