header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-4709
Transcript Name: apobb.2-201
Previous Names: apobb.2-001, apobl-001, ottdart00000020290, si:dkeyp-88f5.1-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000020290 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000020290|OTTDARG00000016844|ZDB-GENE-070705-554 apobb.2|OTTDARP00000017127 DKEYP-88F5.1-001 LG_ CR545462.25 Danio rerio protein_coding NOVEL, 8195 bp
GACCACAATCATGGGTGACCATAAACTCCGTCTGCTGCTG
TTTTTCAGCCTCATCATCTTGTCCATATGCAGAAGATTTA
AACCCCTCAGCAAGCACGAGTATTTCTATGAGACAGAGTC
CTTAAACTCTCTGAACAAGCAGGTCAACGGCCCCAAGGCC
AGCTGCAGGGTACAGTATCAGTCCATTTACACACATCAAA
CACTAAACGCATTGCTGATTGCTCAGAAATACAGTGGGAG
TTTGTTTTAGGTGGAGATTTTGGTTCCTGATGCATCCAAA
TATATTTTGCGCACCACTGACTGTAAGCTGAGTGAAGTGA
CTGCTGTGGATACGGAGGGAAACCCTGTGTTTGGAAAAGC
TGCAGCTGCTGAAGACTTCAGAACTGACATGGAGAAAAAT
CCTCTGAAATTCACCGTTACGAAAGGCGAAATCAGGCTTT
TCCCTGAGAAGGGAGAGCGAGCAAACATCCTCAACATTAA
GAGGGGGATCATCTCTGCTCTCGCTGTGCCTTTGCTGGAG
GAGGACAGGAAAAAAAACACGCCCAGCATCTATGGTCTGT
GTATGACTGAATACACTGTGGACACGGCCACTGCAGTCAC
GCTCAACAGAGACCTGTCCAGATGTGACAAGTTCAGACCC
ATCGAGGACCACACCAGTCCTTTGGCCCTCATAACAGGCT
TGAGCCATCCTCTTGCTCAGCTAATCAGGAGCAACCAGAC
CTGCAACTACAAGTTTGACAAAGAGCAGGAGCACATGACC
TCTGCTATTTGCACCGAAAAACATGTTCTTGTGCCCTTTT
CACACAAGGGAGAATATGGAGTGACCAATACTGGCAAACA
GGTTTTGACGCTATTGGGAGTTACTGAAAACAATGACAGA
GTCTTTGACCACAATATAGCCAACATGAAACCCCTCCATC
TAGACCGCAGTGTTGACATAAGCCCCGTCCAGGATAAAGA
AGCTGCTCTCGCTGTTCTGAGGGAACTTGCTGACCTTTAC
AAAACCAACAGTGGACGCAAGAGAGCCCACTTGGCCTACA
AGCTTGTAGCCGTAATACGCAAGATGGAAGCTGAAACCTT
GAGAGCCGCTCTTCCAGAGGCGCTAGGGATCTCTCGGTCT
TTGACGTACCAGGCCTTGCTGCAATGCGGCACCCCAAAAT
GCAGCAGTGCTATCATGCAGATTATCAGAACCTTTGACAA
GTCTTCGTTTGAGGTGGATGCTGCTGTATATGCCATAGGA
ATTATACCACAGACTTCCCAAGTCCTTGTGAAGGAAATGT
TGGCGACGGCTAAGATCAAGCCAAGCAGACCTATCTACTA
TGCTCTCAGCAATGCTGTGAGAAGGCTGTATGAGACTGAC
GGAGTCACAAGTGAGATCCAGGCAGTGGCCGATTACGCTC
TTGAACAGATTGGTGATTGCACAGGTGACCAGGAACATGT
TTTTCTTTCTCTGAAGGTCATTGGTAACATGGTGGCTGCA
CTAGGAGCTGCACGCCCTGCTTTGCATTCTGCTGTTATTA
AGTGCATCAACCAGCCAGGAGCCTCCCCTGCAGTCCAACA
GGCTGCCATACAGGTCTACAGACAGTTCCCTGTACCTGAG
GAGGGAAGAGAAGTGCTCATGCATACCGTCCTGGACAAAG
TCGCATCAGTACAGAAGCGTGTCGCTGCTTACCTCATCTT
GATGAAGAACCCTACGCCTGCTGAACTTGCTCAGTTGGCA
GCGGCTCTCGAAATTGAGAAAAACCATGAGGCCAAGAGCT
TTATTATCTCTCATATCAGCAGCATCATGGCCTCTACAGC
GCCAGAGACCCTGAATTTGAGGCAGAATATTCAAAATGCC
TTTCAGGGCAATGATATTGAAATGGCAATGAAGTCCACTC
AGTTTTCCAGACACTATAGACTTGGATCTTTGGAGGGAAA
TTTCATCTTTGAATCACCCGACAATCTGCCAAGGGAAGTC
ATGCTGGAGATGACCTTGAATGCTTTCGGACTTGATATGG
ACTTGATTGAGATTGGCATGGAGGGTAAGGGCTTTGAGCC
CATTCTAGAGGCTCTCTTTGGTGAAGATGGTTTCTTCCCA
GACATTGTCATGAAGAGCATTTTATACGCTACTGACAAGA
TGCCTGCTGAACTGAATGAGGTCTGGGACAACATGCTGCC
AAATTTGAACAATTACAGGAAGAAGAGACAGGCGACTCAG
AACATAGTCAAAGAAATCAGTGACAGTGTCAACAAGCTTT
CTGAAGACTTAAAGGCCCAAGATGCCCCTGAAGCTATGGT
TTACCTCAAGCTATTGGGTGCTGAACTTGGGTATCTCGAT
GCAAAAGATGGCAAGATGATTGGCAGTCTTCTTAAGATGA
TCCCCACTGACTTCACCAAAAGACTGTTCTCGAGTGTCGA
CAATGAGCTTTTCCTTCACTACATCTTTATGGATAATGAG
TTCTATCTGCCCACCGCTGCTGGATTTCCACTGAGAGTTG
CTCTGTCTGGCACCTTTACTCCTGGAATCAAAGGAGGATT
GAGCTTTAATCCAGGCATGGGGGACTTTGCGTTCATGCTG
TCTGCTGGGGTTGAGTTGGTGACTGAGATTGGGACTCATT
TACCCGACTATGTTCATTCTGGACTGGAGATGCACACTAA
CATCTATCATGAGAGCGGCCTCAGAGCCAAAATCTCTGGG
ACCCAAAAAAGGCTCAAACTCTCCATTCCAGCTCCTCGTG
AGCCAACTGAGCTCATCAGTGTCACCAATTCTTTGGTGTC
TGTTGTTGGTGGGAAGATTCTGCCTATTTCTGCCAATGTC
CAGTATACTATGGAAGACTGCACTGCTGTTTTTCCTGGAC
TGAAGAGCTGCACAACGCTAGAGTATCCTGATGCAGCATT
AAATGATAATGCTCCTTATTTTCCTCTCACTGGTGACAGC
AGATTTGCTGTTGAGATCCGTCCATCTGGAACAGTCACAG
AGTATACGGCCATCATTGGCTACACATATGAGGATGAAGA
AGACAAACTCACTTTTAGTGTAAAGGCTGAAGGAACACCC
TTTGAGGTCTTAAATACAGTCATGATAAACAGAAAGCTGA
ACACTGCCTCAATGAAGCTGCTTATGGAAGCTCTTCAGCT
TGATCATACGGTTTCTGGAAAATTTACAAATGCTGAGAAG
TTGAAATTAGAACTTCAGAGTGACTTAAAACTCCCCGGGA
CGACTTCTGTTCAAACACTCATCCTGACATATGAGAGTGA
GAAGATTGAGGCTGAAGTTAAATCTCATTTCAATTCAAAG
ACTCGGACCCTCGTTCCCCTTTTCAGGACTGGTGACACCA
TTATCATTGGACTTCTTACCCGCCAGATGGGTCAAAATAA
GATTAAGCTCCTTGACATCATAGCAAAATTAGCTGCGTTT
TCGGGTGTTCCTGCCACACTTGATATCACTCTTCCTGAAG
AACTCTTCCTAAATATAGACGCTGCTGTTAAATATCACTT
TGGCCAGCCGTACTATACCATCACGCTTCCTTTGCCGCTG
GGTGGAAAATCCACAAGAGATCTGAAATTTCCCACAACCC
TCAGCACAGATCTGTTCATAGTGGATCCTGACCTAGAGTC
CATGCAGCTTCCAGAGGTCTCCATTCCTGAGAGTGTGACG
CTGTCTCTGCATGCTTTTCAACTGGCAGATGTATCTGGAA
AACTACGCTGCCACCTCTATGATTTAGACGCAACTGTGTC
TGCTGCCAGAGATCCTGCTGCACACTCCAGTTATTCTGCT
AAGCTCAAAGTCACTGGAACAAGTCCTGTTGAGCAATTCT
GCCTACAGGTTGAAGGATCTGCTCTAGCTGAGGCCACATC
TGGCGATTCTCTAAAAGCTAGCATGAAAACAGTGATTGAA
CACAAGTTTTTCAATGCCACCATCAGTGTTGAAGAAGAAG
TGCAATCTGCAGCAAAACTCAGTGTGAAATCTAAAAGCAA
GCTTGAAGTTACTAGTCTTGTTGCAGAGCAAATGTCCGTG
GAGCATAATGCAATATTTGAAGGTGATGCTGGGCAAATTT
CTGGAGATGGGAACCTGGAAGGATCCTTCAAGGCTGGTTC
AATCTATGGATCAGGAAATCTAAAACAATCAGTTTTGCTT
ATCCCATCCAAACAAGAAGCAAAGATTGACTCCTTACTGA
AAGTAGATTCAAAGCTTCTTCAGGCTCAAAACTCCTTTTC
TGTGGCTTTTGCTAATCGAGAATTGACAGTTTTGTCCACC
ACCACAGCATTTGATGACATTCTAACAAACACTGCTAAAG
TTGCCATCAATGAATCACAGATTGGTTTAAGTTATTATAC
AAAAGCACAAGGATTTGGACTGAAGATCGAAAACACAGCT
GAGACGAGAGCTGATGCTAAAGCTATCAGTGTTAAGATCG
AGACCTCTGGTGATTTATCTCAAGAACGTATTTACTCGAT
AGTCACTGGAGAACTGGACATTAACGGACTGGCTATTAAA
AGTGATGCCTCGGCTAAACTAATGGGACACAGAGCTGCAC
ACAATGCCATCCTGAACTTCAATAAAGATGGCTTGACATC
CAGTGGGACAACCACGCTGCAGAGTATTTTAAGTCAGGAG
AAGGTTAAAAACACCTTTGAGGTCATCTACAAAAAACTAA
CTGCAAATCTTCAATGCAAAACCAATGGAAAGTTCATAGG
AGCGAGCATTGACCACAACACCGAAATGAAGATTAATGGA
CTTTTAGGCAGAATCGAGAATATTTTACGCTTCAACTCCA
GGATCTTAAATGTTGAAACAAACACTCGTGGTACAACTGT
CCCATTTAGTTTTAATTTTAACTTTGCTGCTAATGGTAGT
GAAAATGTATACAATCGTGGACATTACAGAGAAGATTTTA
ACACAAAAATGCATCTAAAAATAGATCCAGAATCCATTAC
TCATTCTCATGAATGCAAGATCTCAACCCTTGTTGAAACA
TATGGTTTCTATGGTGTAGAAGTTGAATCAGAATTTCAGA
GCAAATCTGAACTTCTCCTAAACCCGTCTGAACAAAAGGC
TAAAATGGCTGTAAAGGTTAAAGTAAACAAACATGCAATC
AATCAAGAAATCAATGCATACAATACTCCTGCTCAGTTTG
GGCTGGAAGGATCTGGAAAAGTGTTCACCAATCTGTTAAA
CACTGCTGATGATGATCATCAGGACTTTGCAGTCTCTGCC
TTCCTAAAGTATGATAAAAACAATCAAATGCATTCAATTT
ACCTGCCTTTCGTTGACAGTTTGGGTCTAGTTCCTTCCAG
CGTAATACTAACATATTCAAGCATAGAGGAAACTTTAGCT
TACCTAGCTTACCTAAGCTTACCTAAGCATGTTAGTAACT
TTGTGTCTAATATGAATTTTGGAAGAAGAGCTGAACAATT
CCAACGTGCTTCAATAGCACTATATCAAGAATATCCATTA
AAACTGGGTGTATATGAGAAGCAATTGAGTGATATGATCA
GTCAAATCACTGAAGCATTGAGTAATTTCAAACAATTGAC
TGCAAATGGTATGTTGATTGAAAATGTTGACCGAATGCTG
ACCAAGCACATTAACGCTTTGATGTTTTTAATCACTGAGG
ATGTCAAATTACTTCTTAGCTTACTCAAACCCCAAGGTCA
CACGAAGCTTCAGATTCCTGCAAGTACTAAATCCTATCAA
CTACCCTGTTTTGAAAAAATGCATGGCGAGATCAGATTCA
CCAGCCCTGTTTACAGCCTAAACACATCTGCAGAGTTCAA
GAACGTTTCAGCAACACATCCTCAATTCGCAGGTGTCATC
AAATCTAAAGGAATCTCTGCAAGTCTTGAGGTTTTGAATT
ATAATATAGACTACACCATGCAGATCTCCATTCCTGAGAT
GACCCCTGTATCGGTGTCTGAAACTCTTAAGATAACACAC
TCTTATTTGACTTTAGACCAAAGTGCGTCTTTGACTCTGA
ATGCGTCGATCACTAAAGGTCCTGATTTTTCATCCCTTTC
TCTGGACACATCTTATAAGAACCAGGTTAACATCCCTTTG
CACTCTCTGTCAAGTGAAGTTACACTTGCTTCGAAGGCTG
TAGCAGTGTATCAGAATAACGCTGCAGTGATTTTAAAAGT
TCTGAATACAGGAATTGGCAAATTTACCCTTGAAGACTTC
TCTGATGAAGGCACCCATGACAGTGATCTACTTTTTACCA
TGGGTCTTAGCGCTGCCAAGCTGAGACTTAAAGGCCACAC
TGACAGTTCTGCGTTGCAGATGGAAATGAATGTCGATGTT
GACGCTGATGCCGTAGCTCTAAGCTACCTTAAATTCAATG
TCTTTGCTGAAACAAAGTCACCATTTATCAAGAAGAACTT
GCTGGTTGCTTCTGGGAATGTCTCCATCAATGACATGGAT
GTAAAAATCAGTGGAAACCATGAGACCGAGTTTGATGGAG
TGGTCAGTGTAGTTCTGTCTAATACTGCTAGCGTGATCAT
CTGTCCACGTGAGATCGCAGTTGAGTTTCAGAACAAGGGA
AATGCCAAGACTGACCTTTATGAGTTTTTAATAACCAGTG
TTGATCTCCAGAATGACTACACTGTTATTGTCAACTCCGA
CTTACAAGAAGTCAGCACTATTGCAGTCGCCCAGATAAAT
CATTATAAGTACAGCCATAACTTAACAGCCAACAATAATA
ATGCTGAAATTGGTGTTTACGCTGGTGTGAATAGCTTTGG
CATCCTAAATAATGCAGTGCAGTTTGTGCCATTTGTTTTT
AAAAAGGCCGTAGTTGAATATTTAAAGGATGAAAGTGGCA
TATGGCATGACTTTACAACAAATAACCAAGCCACCGATCT
AAACGCCAAACTTGTCTACCAGAAGACTACCACTGTTTTA
GGTGATTCGGATGGTTTGGCTGTTGTTGTTCCTTCATTGG
GCAACTTAGTCTCTGAAGTGTCTTCAACATCCTCCATTCT
CAACCTCAATGCTAACGCTGGTGTTTATCCCGATGATTAC
TTAATGCGCATTAGTGGCACGGCTACATCTGCATTTCAGC
AATTGAGAGCCAAACTATATGGAGCCACTATCATTACCAC
AGAAAGTGGACTAAAACTGGCCTCGACTTTATTTTTGGAC
AATTCCCAGATTGGGGGCACACATAACAGCTCAGTGACCC
TGCAGGACAACTATGAGGTGGTTTTGGTGTCAGACACAAT
TGCGAAGATTAATCTGACGATATTCTCAATCGAAGCCGAT
CATCAGCTTTCTGCTGACACGAAAACTCATCTGAAGGCTT
TGTCAAACTTGAAGATCAAGTACAGCTTTGATCATCCAGA
CTCACGTGGAGGTGGAGATGCTGAGAATACCTTAAAGATG
AATGCATATTTGTCTTCCATCACTGTTGAGTCTACATCCC
AAGTAACCACCAATTCTACACTGCCTGATGGTGGCGCTCT
TAAGGGAACTCTGGATAGTGATGCAAACATCAGTGTGAAT
GTTGCGGGTCTGAAATCGAATGTGAAAGCCTCTGCAAATG
GATACTATGATTATAGAAACAACAAGCTGAGCTTCGATAT
GAATGACCAAGTGATCTTAGAGGGAAATTTTAACCGTATT
CATTATTTGCTGGACATTGATTCAAACTACACACACAAAT
ATAGAAGAGAAGAAGTTGCAGTGAAACACACTGCTCACGG
TAAAACTACAATTATTCCCATGAGCACCTTCATGGCAGCT
GTCGACTTCTTCTTGACTCAGCCAGATCATGATGATTTTG
AACATAGAGGTGAAGGATTTGGCTATATTAATAAAACATC
TTTATATAATGGCCAGATTTACTCCCGTTGGTTCAATTCA
AGTACAGCGATATCAGTCGAGTCTGATAATGATTCACCAG
ACAGAAAGTTTTTGCTCGAGTGTTCTTTCAATTTCACAGC
TCCATCAGTGCTTGTGGAGTATGAGAGTGAATTAAGATCA
ATTCCCATTAAAATAATCGACGATTATTATTGATATTTTA
AGAATTCATCAAAGTAATGATGTCAGCTAATCGTTGAAGT
TTAACATGTGCTCAGCTCAGCTCACAGATCCACTTCGTTT
TTAAAAATGTATGTAGCTTTTCTGTTGTGTATGAAAGTAT
TATTAAAATTCCCTGAAATATTTCTTGTCAAGTTCAATCT
CTAATGACAATAAATGGATATACTCTACTTATAAA

apobb.2 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA apobb.2-201 8195
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
apobb.2-201 Contained in:
[BAC] DKEYP-88F5 (1)

Genome Resources: Vega_Trans:OTTDART00000020290 (1),  Ensembl_Trans:ENSDART00000138336 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:EH484032 (1) 875 bp
GenBank:CK016989 (1) 855 bp
GenBank:EE719054 (1) 822 bp
GenBank:DT079925 (1) 750 bp
GenBank:DT081923 (1) 722 bp
GenBank:EB771256 (1) 495 bp
GenBank:AI959738 (1) 479 bp
CITATIONS (2)