ZFIN ID: ZDB-TSCRIPT-090929-4706
Transcript Name: illr3-201
Previous Name: illr3-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000020282 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000020282|OTTDARG00000014108|ZDB-GENE-050311-4 illr3|OTTDARP00000017118 illr3-002 LG_ AL928975.10 Danio rerio protein_coding KNOWN, 1258 bp
CAAGCGCTCAAATCTCAGCAAAGTCTCAAGTTCACAGAAA
TGGGTTCTGTCTATGAAAATTCTGTGTTCGCCTTTTCAAC
AGGTAATTCTGATGAAAATGACTCCCAGTACAAAGGTCAC
TTCAGCAATTACCGAGAAAGTAAAAGAGAAGTCAATACTG
CAAAGTGGACAAAAGTTCTGCTGATTGTTTTTGCTGTGTC
TCTGGTTTTTGCTCTTGGAGGTCTCTGTGCTGTAAGGATA
CAGTATGTCAGTGTTTCAGCGCAGTTGTCTGCCCAGGAAA
CTAATGGCACAATGCTGATGAAAGAGCTGACAGCAAACTA
CAGCCGAGTTAAAGAACAACTGTCCATTTCTGAAGAGACG
GTTAGAAAGCTGAGCAGATTTAATCAAAGCAGCGGCTGTG
CGATCTGTGCCATTCACTGGACTCATTCTGGAGAAAAGTG
TTACTACTTCTCTACAGTCAAGATGAACTGGACACAGAGT
CGAGATCACTGTGTGACCAAAGGAGGACATTTAGTGATCA
TAACCAGCCAAGCAGAGCAGGAGTTTCTAACCTCTAATGT
TAAAGAGACTCACTGGATTGGTCTTAATGATTTGGACACT
GAGGGACGCTGGCTTTGGGTGGACAACCAGCCACTGAGCC
AAACAGAAGAATTCTGGATGAAGCGAGAGAATGGGGTCAG
TGAGCCTGATAACTGGACTAAACAGCATGTGGACGGTGAA
GACTGCGCTAGTCTGGGTCACCCAGACGGAGAGACAGATT
TCTGGACTGATGCTTACTGTTTTGAAGAGAAAAGATTTGT
GTGTGAAGCTGCAGCAGCTGTTTGATCCAATCCTGCTGTC
AAAATACACTTCTGTTATTAGTATCACGGCTTATAAACAA
AGTAATTTTCACAAAGCTTATTAAATGAACTGAATGGCTT
ATATTTTGAGACTGTGCTTCATGAAGCATTACAGAGACTG
TATATTAGGGGTGTCAAAAATAATCGTTTTTTCGGTGCAC
TGCGATGCAGACGCGGACAGTTCGGTATCGGTTCAGTAAT
AATCATAACCGGTTATTACTGACGTCATTTACCTCATATG
CGCTCTGTCGCGAGGGAGGCGATCGCGAGTATTTACAGCG
CTTTAACTACTTAAAACTCATAAACTGTCCACAATTTCAC
TGTGTGTGTTTGCTGGATCAGTCTTTCACTGACATATACA
ACAAAAGCCCCTATTTCACTGAGATCGAGAGATGAAAGTA
GCCTACTCCATTTCTCTC

illr3 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA illr3-201 1258
illr3-202 (1)    Ensembl 1357
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
illr3-201 Contained in:
[BAC] CH211-133N4 (1)

Genome Resources: Vega_Trans:OTTDART00000020282 (1),  Ensembl_Trans:ENSDART00000087163 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:AY986757 (1) 852 nt
GenBank:BC163144 (1) 848 nt
CITATIONS (2)