Transcript

illr3-201

ID
ZDB-TSCRIPT-090929-4706
Name
illr3-201
Previous Names
  • illr3-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000020282 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000020282|OTTDARG00000014108|ZDB-GENE-050311-4 illr3|OTTDARP00000017118 illr3-002 LG_ AL928975.10 Danio rerio protein_coding KNOWN, 1258 bp
CAAGCGCTCAAATCTCAGCAAAGTCTCAAGTTCACAGAAA
TGGGTTCTGTCTATGAAAATTCTGTGTTCGCCTTTTCAAC
AGGTAATTCTGATGAAAATGACTCCCAGTACAAAGGTCAC
TTCAGCAATTACCGAGAAAGTAAAAGAGAAGTCAATACTG
CAAAGTGGACAAAAGTTCTGCTGATTGTTTTTGCTGTGTC
TCTGGTTTTTGCTCTTGGAGGTCTCTGTGCTGTAAGGATA
CAGTATGTCAGTGTTTCAGCGCAGTTGTCTGCCCAGGAAA
CTAATGGCACAATGCTGATGAAAGAGCTGACAGCAAACTA
CAGCCGAGTTAAAGAACAACTGTCCATTTCTGAAGAGACG
GTTAGAAAGCTGAGCAGATTTAATCAAAGCAGCGGCTGTG
CGATCTGTGCCATTCACTGGACTCATTCTGGAGAAAAGTG
TTACTACTTCTCTACAGTCAAGATGAACTGGACACAGAGT
CGAGATCACTGTGTGACCAAAGGAGGACATTTAGTGATCA
TAACCAGCCAAGCAGAGCAGGAGTTTCTAACCTCTAATGT
TAAAGAGACTCACTGGATTGGTCTTAATGATTTGGACACT
GAGGGACGCTGGCTTTGGGTGGACAACCAGCCACTGAGCC
AAACAGAAGAATTCTGGATGAAGCGAGAGAATGGGGTCAG
TGAGCCTGATAACTGGACTAAACAGCATGTGGACGGTGAA
GACTGCGCTAGTCTGGGTCACCCAGACGGAGAGACAGATT
TCTGGACTGATGCTTACTGTTTTGAAGAGAAAAGATTTGT
GTGTGAAGCTGCAGCAGCTGTTTGATCCAATCCTGCTGTC
AAAATACACTTCTGTTATTAGTATCACGGCTTATAAACAA
AGTAATTTTCACAAAGCTTATTAAATGAACTGAATGGCTT
ATATTTTGAGACTGTGCTTCATGAAGCATTACAGAGACTG
TATATTAGGGGTGTCAAAAATAATCGTTTTTTCGGTGCAC
TGCGATGCAGACGCGGACAGTTCGGTATCGGTTCAGTAAT
AATCATAACCGGTTATTACTGACGTCATTTACCTCATATG
CGCTCTGTCGCGAGGGAGGCGATCGCGAGTATTTACAGCG
CTTTAACTACTTAAAACTCATAAACTGTCCACAATTTCAC
TGTGTGTGTTTGCTGGATCAGTCTTTCACTGACATATACA
ACAAAAGCCCCTATTTCACTGAGATCGAGAGATGAAAGTA
GCCTACTCCATTTCTCTC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations