Transcript

illr3-202

ID
ZDB-TSCRIPT-090929-3541
Name
illr3-202
Previous Names
  • illr3-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000016822 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000016822|OTTDARG00000014108|ZDB-GENE-050311-4 illr3|OTTDARP00000014257 illr3-001 LG_ AL928975.10 Danio rerio protein_coding KNOWN, 1357 bp
TTCCTTCCTGTCAATAAAAATGACCCTTAATAAGACTTCC
TTTTTCCTCAACAACCTCAACAAGCGCTCAAATCTCAGCA
AAGTCTCAAGTTCACAGAAATGGGTTCTGTCTATGAAAAT
TCTGTGTTCGCCTTTTCAACAGGTCACTTCAGCAATTACC
GAGAAAGTAAAAGAGAAGTCAATACTGCAAAGTGGACAAA
AGTTCTGCTGATTGTTTTTGCTGTGTCTCTGGTTTTTGCT
CTTGGAGGTCTCTGTGCTGTAAGGATACAGTATGTCAGTG
TTTCAGCGCAGTTGTCTGCCCAGGAAACTAATGGCACAAT
CATGTCCAGACAGCTTGACAAACTTACAGCCAACTTTACC
ACAGTTAGAGATCATCTCCACATTAATGAATTGCTGATGA
AAGAGCTGACAGCAAACTACAGCCGAGTTAAAGAACAACT
GTCCATTTCTGAAGAGACGGTTAGAAAGCTGAGCAGATTT
AATCAAAGCAGCGGCTGTGCGATCTGTGCCATTCACTGGA
CTCATTCTGGAGAAAAGTGTTACTACTTCTCTACAGTCAA
GATGAACTGGACACAGAGTCGAGATCACTGTGTGACCAAA
GGAGGACATTTAGTGATCATAACCAGCCAAGCAGAGCAGG
AGTTTCTAACCTCTAATGTTAAAGAGACTCACTGGATTGG
TCTTAATGATTTGGACACTGAGGGACGCTGGCTTTGGGTG
GACAACCAGCCACTGAGCCAAACAGAAGAATTCTGGATGA
AGCGAGAGAATGGGGTCAGTGAGCCTGATAACTGGACTAA
ACAGCATGTGGACGGTGAAGACTGCGCTAGTCTGGGTCAC
CCAGACGGAGAGACAGATTTCTGGACTGATGCTTACTGTT
TTGAAGAGAAAAGATTTGTGTGTGAAGCTGCAGCAGCTGT
TTGATCCAATCCTGCTGTCAAAATACACTTCTGTTATTAG
TATCACGGCTTATAAACAAAGTAATTTTCACAAAGCTTAT
TAAATGAACTGAATGGCTTATATTTTGAGACTGTGCTTCA
TGAAGCATTACAGAGACTGTATATTAGGGGTGTCAAAAAT
AATCGTTTTTTCGGTGCACTGCGATGCAGACGCGGACAGT
TCGGTATCGGTTCAGTAATAATCATAACCGGTTATTACTG
ACGTCATTTACCTCATATGCGCTCTGTCGCGAGGGAGGCG
ATCGCGAGTATTTACAGCGCTTTAACTACTTAAAACTCAT
AAACTGTCCACAATTTCACTGTGTGTGTTTGCTGGATCAG
TCTTTCACTGACATATACAACAAAAGCCCCTATTTCACTG
AGATCGAGAGATGAAAGTAGCCTACTCCATTTCTCTC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations