ZFIN ID: ZDB-TSCRIPT-090929-3541
Transcript Name: illr3-202
Previous Name: illr3-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000016822 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000016822|OTTDARG00000014108|ZDB-GENE-050311-4 illr3|OTTDARP00000014257 illr3-001 LG_ AL928975.10 Danio rerio protein_coding KNOWN, 1357 bp
TTCCTTCCTGTCAATAAAAATGACCCTTAATAAGACTTCC
TTTTTCCTCAACAACCTCAACAAGCGCTCAAATCTCAGCA
AAGTCTCAAGTTCACAGAAATGGGTTCTGTCTATGAAAAT
TCTGTGTTCGCCTTTTCAACAGGTCACTTCAGCAATTACC
GAGAAAGTAAAAGAGAAGTCAATACTGCAAAGTGGACAAA
AGTTCTGCTGATTGTTTTTGCTGTGTCTCTGGTTTTTGCT
CTTGGAGGTCTCTGTGCTGTAAGGATACAGTATGTCAGTG
TTTCAGCGCAGTTGTCTGCCCAGGAAACTAATGGCACAAT
CATGTCCAGACAGCTTGACAAACTTACAGCCAACTTTACC
ACAGTTAGAGATCATCTCCACATTAATGAATTGCTGATGA
AAGAGCTGACAGCAAACTACAGCCGAGTTAAAGAACAACT
GTCCATTTCTGAAGAGACGGTTAGAAAGCTGAGCAGATTT
AATCAAAGCAGCGGCTGTGCGATCTGTGCCATTCACTGGA
CTCATTCTGGAGAAAAGTGTTACTACTTCTCTACAGTCAA
GATGAACTGGACACAGAGTCGAGATCACTGTGTGACCAAA
GGAGGACATTTAGTGATCATAACCAGCCAAGCAGAGCAGG
AGTTTCTAACCTCTAATGTTAAAGAGACTCACTGGATTGG
TCTTAATGATTTGGACACTGAGGGACGCTGGCTTTGGGTG
GACAACCAGCCACTGAGCCAAACAGAAGAATTCTGGATGA
AGCGAGAGAATGGGGTCAGTGAGCCTGATAACTGGACTAA
ACAGCATGTGGACGGTGAAGACTGCGCTAGTCTGGGTCAC
CCAGACGGAGAGACAGATTTCTGGACTGATGCTTACTGTT
TTGAAGAGAAAAGATTTGTGTGTGAAGCTGCAGCAGCTGT
TTGATCCAATCCTGCTGTCAAAATACACTTCTGTTATTAG
TATCACGGCTTATAAACAAAGTAATTTTCACAAAGCTTAT
TAAATGAACTGAATGGCTTATATTTTGAGACTGTGCTTCA
TGAAGCATTACAGAGACTGTATATTAGGGGTGTCAAAAAT
AATCGTTTTTTCGGTGCACTGCGATGCAGACGCGGACAGT
TCGGTATCGGTTCAGTAATAATCATAACCGGTTATTACTG
ACGTCATTTACCTCATATGCGCTCTGTCGCGAGGGAGGCG
ATCGCGAGTATTTACAGCGCTTTAACTACTTAAAACTCAT
AAACTGTCCACAATTTCACTGTGTGTGTTTGCTGGATCAG
TCTTTCACTGACATATACAACAAAAGCCCCTATTTCACTG
AGATCGAGAGATGAAAGTAGCCTACTCCATTTCTCTC

illr3 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA illr3-201 (1)    Ensembl 1258
illr3-202 1357
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
illr3-202 Contained in:
[BAC] CH211-133N4 (1)

Genome Resources: Vega_Trans:OTTDART00000016822 (1),  Ensembl_Trans:ENSDART00000105154 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:AY986756 (1) 951 nt
GenBank:CK238996 (1) 793 nt
CITATIONS (2)