ZFIN ID: ZDB-TSCRIPT-090929-4667
Transcript Name: actc1-201
Previous Name: zgc:86709-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000020126 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000020126|OTTDARG00000016731|ZDB-GENE-040625-35 zgc:86709|OTTDARP00000017000 RP71-1C22.1-001 LG_ AL645822.24 Danio rerio protein_coding KNOWN, 1570 bp
CAGGACGAAAAGCCTAGCGCGGGTCTCGGGCTCTCCTCTC
TGCGCCCTTCCATTCATGGCCACTCCGCTCTCAATGGCGC
TCGGGCTACCAAATATGGAGAGGGAAGTCCAGCGACCCAG
GGCCACTCAGTGTCTATAAATTGGCCGTGACTCAAGGCGC
TTTCTACCATTCACTCTCCAAGGGAACCAGCTCCTGGTGC
TGATCTGAACCCCAGCTGACACCATGTGTGATGACGATGA
GACCACTGCTCTTGTGTGTGACAATGGCTCTGGCCTGGTG
AAGGCTGGCTTTGCTGGAGATGATGCTCCTCGTGCTGTCT
TTCCCTCCATTGTTGGTCGTCCTCGCCACCAGGGTGTGAT
GGTAGGTATGGGACAGAAAGACTCTTACGTGGGTGATGAG
GCCCAGAGCAAGAGAGGCATCCTGACCTTGAAGTACCCGA
TTGAGCACGGCATTATCACCAACTGGGATGATATGGAGAA
GATCTGGCACCATACCTTCTACAATGAGCTGCGTGTGGCC
CCTGAGGAACACCCTACGCTGCTCACAGAGGCTCCACTTA
ACCCTAAAGCCAACAGAGAGAAAATGACACAGATCATGTT
TGAGACCTTTAATGTTCCGGCCATGTATGTGGCTATCCAG
GCTGTGCTTTCACTGTATGCTTCTGGCCGTACCACTGGTA
TTGTGCTGGACTCTGGAGATGGAGTGACCCACAACGTTCC
CATCTACGAGGGTTATGCTCTGCCCCATGCCATAATGCGT
CTGGATTTGGCCGGTCGTGACCTGACTGACTACCTGATGA
AAATCCTGACTGAACGCGGCTACTCTTTTGTGACCACTGC
TGAGCGTGAGATTGTGCGTGACATCAAGGAGAAGCTGTGC
TACGTAGCTCTGGACTTTGAGAATGAAATGGCCACTGCTG
CTTCCTCTTCTTCTCTGGAGAAGTCCTACGAGTTGCCTGA
TGGCCAGGTCATCACTATTGGAAATGAACGTTTCCGTTGC
CCCGAGACCCTATTTCAGCCTTCCTTCATTGGTATGGAGT
CTGCTGGCATCCATGAGACCACCTACAACAGCATCATGAA
GTGCGACATTGACATCCGTAAGGACTTGTATGCCAACAAC
GTCCTATCTGGCGGCACCACCATGTACCCAGGTATTGCTG
ACCGTATGCAGAAGGAGATCACAGCTCTGGCCCCCAGCAC
CATGAAGATCAAGATCATCGCTCCCCCTGAGCGCAAATAC
TCAGTCTGGATTGGTGGCTCCATCCTGGCTTCCCTGTCCA
CCTTCCAGCAGATGTGGATCAGCAAACAGGAATATGATGA
GGCCGGTCCATCCATCGTCCATAGAAAGTGCTTCTAAATG
TAATGATGCCCAGGATACGCTACTGATTTTGAATGATAAC
CTGCTCAAATTCTTAACATTACCTCCGCATGTTATGCATG
CAGGCAGTTTTTGCCTTTATATTTCCTTGTACAGTATGTT
TACACCAAAGTGCACATTTTTTGTAGTTATGTACTTGTTC
CTAAATTAATTTGTATGTGAATATTTATTGGTTTTTAAAT
AAACAATAAT

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
actc1-201 Contained in:
[BAC] RP71-1C22 (1)

Genome Resources: Vega_Trans:OTTDART00000020126 (1),  Ensembl_Trans:ENSDART00000080664 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC071386 (1) 1436 nt
GenBank:CT620781 (1) 812 nt
CITATIONS (2)