Transcript

mpp5a-202

ID
ZDB-TSCRIPT-090929-4666
Name
mpp5a-202
Previous Names
  • mpp5a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000020112 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000020112|OTTDARG00000016721|ZDB-GENE-020712-1 mpp5a|OTTDARP00000016990 mpp5-001 LG_ BX679675.28 Danio rerio protein_coding KNOWN, 2903 bp
TAAGGCCAAGGAGTGACAGACCTTTAGCATTCAGAGGACG
AGAGGAAGCAGACAAGCCAGCACTGACGACAGAGGACACC
CTGCTACACTCTGGAGTTCTTATTCTGGGCTGACTGGCAA
ACACGGGTGTGGCTCAGTGTCTGGAGCCGCTGCTGACCTC
AGCCCTGCTGTCATGGCCTCAGCCCTCACACCATGCAGAA
AGCACCCCTCCTAACCCTCATACCTCACACACACTTGCAC
CACACACCACCACACATGCGCGCAGCCATGATGACCACCT
CCCACATGAACGGATATGTGACCGAGTCAGATGGCGGGGG
AGGTACTGACATCGTGGAAGAGGGGGTGCAGAGGCACAGG
GAGATGGCGGTGGACTGCCCAAGTGAGCTGGGTGCCCGCA
CCCTGCCCGTCAGACGCAGCGCTCAGCTGGAAAAGATCCG
CCAGCAGCAGGAGGACCGCAGAAGACGAGAGGAGGAGGGC
CGCAGCCGGCAGGAGCTTGACCTCAACTCGTCCATGCGCC
TCAAGAAACTCTCCCAGAACCCAAAAGTGGGCATCGATAA
CCCCACCTTTGAGCAAATGGAAGGTCCTGGTGGCTCCGCA
GGTGGTCTTCAGAGCCTCATCGCACCACCAGCTTTACTAG
AGCTGGAGGACCTGTTGATGTCCCTTAAGCAGGTGCAGCA
TAATTTGAATGACTCTCAAAGTCAAGAGGACGTGGAGCTG
GTTCTACAGCTGGTCCAGAAGCCTGACTTCCAGAAAGCCT
TCAGCATTCACAACTCTGTGGCCCACTATATGAACCGGCC
CAGCCCCCCCTACCCCCTGACGGATCACGCACAGACCCTG
GCTCAAGAGGTGGAGGTCATGGTGCAAAACAGCTCACACA
AGGAAGGACTTGAGCTAAGCAGCCTGCTCTCAACGTCCCA
CATGCAGGCGCTCATGATGGCACATGACAGCGTGGCTGAA
CAAGAGATGCAGCTGGAGCCTCTTGTTCCTTCTGTCAATG
CAAGCGAGACTCTCACCCAGTGGGGAGGAGAGACTGTCAA
AATTGTACGGATTGAAAAAGCCAAGGACATCCCATTGGGA
GCGACTGTTAGAAATGATATGGACAGTGTGGTCATCAGCC
GGATTGTTAAAGGGGGGGCGGCAGAACGCAGCGGCCTGCT
ACACGAAGGAGACGAGATCCTGGAGATCAACGGTGTGGAA
ATCCGTGGCAAAGATGTCAACGAAGTCTTCGACATCCTGG
CGGACATGCATGGTGTACTGTCTTTTGTTCTCATCCCCAG
CGCACAGATCAAATCTCCTCCTATTAAAGAGACTGTGGTA
CATGTGAAGGCACATTTTGACTATGACCCCTCAGATGACC
CATATGTGCCATGCCGAGAGCTCGGCCTGTGCTTTCAGAA
GGGGGATATACTCCACATAATCAGCCAAGACGACCCCAAC
TGGTGGCAGGCCTACAGAGATGGGGATGAAGACAACCAGC
CTCTTGCTGGCCTCGTCCCTGGCAAAAGTTTTCAGCAGCA
GAGGGAGGCAATGAAGCAAACCATAGAAGAGGATAAAGAG
CCTGAAAAATCAGGAAAGCTTTGGTGTGCTAAAAAGACCA
AGAAGAAGCGGAAGAAGATGCAATACAATGCTAACAAAAA
TGATGACTTTGATAATGAGGAGATTCTCACATATGAAGAA
ATGGCACTTTACCACCAACCAGCCAATCGTAAGCGGCCCA
TCGCACTAATCGGCCCACCGAACTGTGGGCAAAATGAGCT
CAGACAAAGACTCCTCTCCACTGAGCCGGACAGGTTTGCT
GGACCTGTTCCTCACACCACACGGAGTCGACGTGACGCTG
AGGCGAACGGCCGTGACTACCACTTTGTGTCCCGCCAGGC
CTTCGAGATGGACTCTGCAGCAGGGAAATTCATAGAGTCC
GGAGAGTTTGAAAAGAACTTTTACGGCACCAGCACAGACT
CTGTCCGACAAGTCATCAACACAGGCAAAATCTGCCTCCT
GTGCGTACACACCCAGTCTTTGAAGGTGTTGCGCAGCTCG
GACCTCAAGCCCTACATCATCTTCATCGCTCCTCCATCCC
AAGAGCGATTGAGAGCCCTCTTAGCTAAAGACAACAAAAA
CCCAAAGCCCGAGGAGCTGCGAGACATTATCGAGAAGGCC
CGAGAGATGGAGCAGAACTACGGCCACCTGTTTGATGCTG
CCATTGTGAACACCGACCTGGACAAATCCTACCAGGAGCT
GCTGCGTCTCATCAATAAACTAGACACTGAACCCCAGTGG
GTCCCTTCATCCTGGCTGCGCTGAGATGGGTGAAAATGAA
GAGCACGTTGTTTATCAATGCTTTAGAATGCCTCTGTTTT
TCTTGTTTTCTTCTCCTCACTCATAGATAAGGACACTATA
CGCGCCCTCAAGCCCGCACAGAAGTGTCTGTCTGCACTAC
ACTGTCGGCAGGCTGAGGGAATGAGAGTTTTAATGTCATA
ACTTGTGTTTTCGAGTCCGGTTATCCACATTCCAGTGAGA
AAGTTACCAGCACTTGGTGCAGCAGTAGAATTAGGGCTTC
TATACTGCTTTTGATAACTATTTATGATTGTAAATATTCT
ATATGTATTTTTAAAGATGGATTTGGACAAATGCAGAGGT
GGGACAAGATAGCTGGAAGTCAGCATTTTTCAAGAGATCT
ATTCAGACTCCAGAACGGACATTCGTACACTCTGTTCTCT
TCTCTTTCATCCTTAACCTCTACAATGTTACAAGAACATC
CTGCGTCTGAACAACTCTTCCAGGACACTAAATGGGATGA
AAGTGGAAGCGAGCGATGCCTTTTTGTCCCTTCAGTGTTA
TGGCGAAGCAGCACTGCGATTGTGACAGAGTTTAAATACG
AATAAACTTCAGGTTTTCTTCCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations