header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-4666
Transcript Name: mpp5a-202
Previous Name: mpp5a-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000020112 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000020112|OTTDARG00000016721|ZDB-GENE-020712-1 mpp5a|OTTDARP00000016990 mpp5-001 LG_ BX679675.28 Danio rerio protein_coding KNOWN, 2903 bp
TAAGGCCAAGGAGTGACAGACCTTTAGCATTCAGAGGACG
AGAGGAAGCAGACAAGCCAGCACTGACGACAGAGGACACC
CTGCTACACTCTGGAGTTCTTATTCTGGGCTGACTGGCAA
ACACGGGTGTGGCTCAGTGTCTGGAGCCGCTGCTGACCTC
AGCCCTGCTGTCATGGCCTCAGCCCTCACACCATGCAGAA
AGCACCCCTCCTAACCCTCATACCTCACACACACTTGCAC
CACACACCACCACACATGCGCGCAGCCATGATGACCACCT
CCCACATGAACGGATATGTGACCGAGTCAGATGGCGGGGG
AGGTACTGACATCGTGGAAGAGGGGGTGCAGAGGCACAGG
GAGATGGCGGTGGACTGCCCAAGTGAGCTGGGTGCCCGCA
CCCTGCCCGTCAGACGCAGCGCTCAGCTGGAAAAGATCCG
CCAGCAGCAGGAGGACCGCAGAAGACGAGAGGAGGAGGGC
CGCAGCCGGCAGGAGCTTGACCTCAACTCGTCCATGCGCC
TCAAGAAACTCTCCCAGAACCCAAAAGTGGGCATCGATAA
CCCCACCTTTGAGCAAATGGAAGGTCCTGGTGGCTCCGCA
GGTGGTCTTCAGAGCCTCATCGCACCACCAGCTTTACTAG
AGCTGGAGGACCTGTTGATGTCCCTTAAGCAGGTGCAGCA
TAATTTGAATGACTCTCAAAGTCAAGAGGACGTGGAGCTG
GTTCTACAGCTGGTCCAGAAGCCTGACTTCCAGAAAGCCT
TCAGCATTCACAACTCTGTGGCCCACTATATGAACCGGCC
CAGCCCCCCCTACCCCCTGACGGATCACGCACAGACCCTG
GCTCAAGAGGTGGAGGTCATGGTGCAAAACAGCTCACACA
AGGAAGGACTTGAGCTAAGCAGCCTGCTCTCAACGTCCCA
CATGCAGGCGCTCATGATGGCACATGACAGCGTGGCTGAA
CAAGAGATGCAGCTGGAGCCTCTTGTTCCTTCTGTCAATG
CAAGCGAGACTCTCACCCAGTGGGGAGGAGAGACTGTCAA
AATTGTACGGATTGAAAAAGCCAAGGACATCCCATTGGGA
GCGACTGTTAGAAATGATATGGACAGTGTGGTCATCAGCC
GGATTGTTAAAGGGGGGGCGGCAGAACGCAGCGGCCTGCT
ACACGAAGGAGACGAGATCCTGGAGATCAACGGTGTGGAA
ATCCGTGGCAAAGATGTCAACGAAGTCTTCGACATCCTGG
CGGACATGCATGGTGTACTGTCTTTTGTTCTCATCCCCAG
CGCACAGATCAAATCTCCTCCTATTAAAGAGACTGTGGTA
CATGTGAAGGCACATTTTGACTATGACCCCTCAGATGACC
CATATGTGCCATGCCGAGAGCTCGGCCTGTGCTTTCAGAA
GGGGGATATACTCCACATAATCAGCCAAGACGACCCCAAC
TGGTGGCAGGCCTACAGAGATGGGGATGAAGACAACCAGC
CTCTTGCTGGCCTCGTCCCTGGCAAAAGTTTTCAGCAGCA
GAGGGAGGCAATGAAGCAAACCATAGAAGAGGATAAAGAG
CCTGAAAAATCAGGAAAGCTTTGGTGTGCTAAAAAGACCA
AGAAGAAGCGGAAGAAGATGCAATACAATGCTAACAAAAA
TGATGACTTTGATAATGAGGAGATTCTCACATATGAAGAA
ATGGCACTTTACCACCAACCAGCCAATCGTAAGCGGCCCA
TCGCACTAATCGGCCCACCGAACTGTGGGCAAAATGAGCT
CAGACAAAGACTCCTCTCCACTGAGCCGGACAGGTTTGCT
GGACCTGTTCCTCACACCACACGGAGTCGACGTGACGCTG
AGGCGAACGGCCGTGACTACCACTTTGTGTCCCGCCAGGC
CTTCGAGATGGACTCTGCAGCAGGGAAATTCATAGAGTCC
GGAGAGTTTGAAAAGAACTTTTACGGCACCAGCACAGACT
CTGTCCGACAAGTCATCAACACAGGCAAAATCTGCCTCCT
GTGCGTACACACCCAGTCTTTGAAGGTGTTGCGCAGCTCG
GACCTCAAGCCCTACATCATCTTCATCGCTCCTCCATCCC
AAGAGCGATTGAGAGCCCTCTTAGCTAAAGACAACAAAAA
CCCAAAGCCCGAGGAGCTGCGAGACATTATCGAGAAGGCC
CGAGAGATGGAGCAGAACTACGGCCACCTGTTTGATGCTG
CCATTGTGAACACCGACCTGGACAAATCCTACCAGGAGCT
GCTGCGTCTCATCAATAAACTAGACACTGAACCCCAGTGG
GTCCCTTCATCCTGGCTGCGCTGAGATGGGTGAAAATGAA
GAGCACGTTGTTTATCAATGCTTTAGAATGCCTCTGTTTT
TCTTGTTTTCTTCTCCTCACTCATAGATAAGGACACTATA
CGCGCCCTCAAGCCCGCACAGAAGTGTCTGTCTGCACTAC
ACTGTCGGCAGGCTGAGGGAATGAGAGTTTTAATGTCATA
ACTTGTGTTTTCGAGTCCGGTTATCCACATTCCAGTGAGA
AAGTTACCAGCACTTGGTGCAGCAGTAGAATTAGGGCTTC
TATACTGCTTTTGATAACTATTTATGATTGTAAATATTCT
ATATGTATTTTTAAAGATGGATTTGGACAAATGCAGAGGT
GGGACAAGATAGCTGGAAGTCAGCATTTTTCAAGAGATCT
ATTCAGACTCCAGAACGGACATTCGTACACTCTGTTCTCT
TCTCTTTCATCCTTAACCTCTACAATGTTACAAGAACATC
CTGCGTCTGAACAACTCTTCCAGGACACTAAATGGGATGA
AAGTGGAAGCGAGCGATGCCTTTTTGTCCCTTCAGTGTTA
TGGCGAAGCAGCACTGCGATTGTGACAGAGTTTAAATACG
AATAAACTTCAGGTTTTCTTCCA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
mpp5a-202 Contained in:
OTHER mpp5a-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000020112 (1)
  • Ensembl_Trans:ENSDART00000136167 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AF510111 (1) 3073bp
    CITATIONS (2)