ZFIN ID: ZDB-TSCRIPT-090929-4665
Transcript Name: eif2s1a-201
Previous Names: eif2s1a-001, eif2s1l-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000020111 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000020111|OTTDARG00000016720|ZDB-GENE-030131-526 eif2s1a|OTTDARP00000016989 eif2s1l-001 LG_ BX679675.28 Danio rerio protein_coding KNOWN, 1523 bp
TCCGGCTGATGTTCAACATGCTGAGGAAATAGACATCAGA
GACAACGCCAAGTTTTCCCCGGTTACTTTTATTTTCCACA
GATGCGCTTGTGGTTTTTAATTATCAAGTTAAGGACAATT
GTTGAACGACAGTACTAGCACATTTGTCCTGCATATCGGG
TGAAGATGCCAGCACTCAGCAGTAGATTCTACCAGCACAG
GTTTCCAGAGGTGGAGGATGTAGTGATGGTCAATGTCAGG
TCAATTGCAGAAATGGGCGCTTACGTCAGTCTGCTGGAGT
ACAACAACATCGAGGGGATGATTTTGCTCAGCGAGCTGTC
CAGGCGACGAATCCGATCCATCAACAAACTCATCCGGATC
GGACGCAACGAGTGTGTGGTGGTCATTCGGGTGGATAAGG
AGAAAGGCTACATTGATTTATCCAAAAGAAGAGTGTCGCC
AGAAGAGGCCATTAAATGTGAAGACAAGTTCACAAAGTCT
AAAACTGTTTACAGCATTTTAAGGCATGTTGCTGAAGTCC
TGGAGTACACCAAAGATGAGCAGCTGGAGAGTCTGTATCA
GAGAACCGCTTGGGTGTTTGATGAGAAGTACAAGCGGCCT
GGATACGGTGCTTATGACGTCTTTAAGCAGGCTGTGTCGG
ATCCAGCTATATTAGATTGTCTGGAATTGACAGAGGAGGA
ACGAGCAGTCCTGATTGATAACATCAACAGACGCCTCACT
CCACAGGCTGTCAAAATCCGAGCAGACATTGAGGTGGCCT
GCTATGGGTATGAGGGCATCGATGCAGTGAAGGAGGCTTT
GAGAGCAGGACTAACATGTTCAACAGAGTGCATGCCCATC
AAGATCAACTTGATTGCTCCTCCTCGATATGTTATGACCA
CGACCACACTGGAGCGCACAGAGGGCCTTTCTGTGCTCAA
TCAAGCCATGGCCGTCATTAAAGAGAAGATCGAAGAGAAG
AGAGGCGTCTTCAACATTCAGATGGAGCCAAAAGTTGTGA
CGGACACGGATGAGACGGAGCTGGCACGACAGTTGGAGCG
GCTGGAGAGAGAAAATGCTGAGGTGGATGGAGATGATGAT
GCAGAGGAAATGGAGGCCAAGACTGAGGACTAGTCTGAAG
AAAGACGACAAACCAGCAGTGCTATAATCATTCCAGAGAC
TTCAGAGTTATAGTGAAGGGGTTATCACATCATGAAGACT
GAAAAAAAACACTGCTTCTGTGATACTAAGCAGATTGTGA
GTGAGAGATGTGGACTACATTGATGTACTTTTGCTTATCG
GATGAGAATCGTGAGAGGAATTTCTTCCATGAACACTAGT
TTTACTTTAGGAATGTTAGTACAGATAGTATTGTAGTTGA
TTTAAGTGACCTTCGTTTCCAGCTTTATTCAAGATGAGAT
TTGTGGTAAAAAAAAACAAACAAAAAAAAAACAAGCAAAA
CTGAAATCTTTATAGACAGCCAGCCAGTTTACTTATCAAA
AATCTGTTCCACAGAGCTAATAAAAACAAGCAGTTTTCAT
GTA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
eif2s1a-201 Contained in:
[BAC] CH211-37L23 (1)

Genome Resources: Vega_Trans:OTTDART00000020111 (1),  Ensembl_Trans:ENSDART00000006058 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC049468 (1) 1539 nt
CITATIONS (2)