Transcript

eif2s1a-201

ID
ZDB-TSCRIPT-090929-4665
Name
eif2s1a-201
Previous Names
  • eif2s1a-001
  • eif2s1l-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000020111 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000020111|OTTDARG00000016720|ZDB-GENE-030131-526 eif2s1a|OTTDARP00000016989 eif2s1l-001 LG_ BX679675.28 Danio rerio protein_coding KNOWN, 1523 bp
TCCGGCTGATGTTCAACATGCTGAGGAAATAGACATCAGA
GACAACGCCAAGTTTTCCCCGGTTACTTTTATTTTCCACA
GATGCGCTTGTGGTTTTTAATTATCAAGTTAAGGACAATT
GTTGAACGACAGTACTAGCACATTTGTCCTGCATATCGGG
TGAAGATGCCAGCACTCAGCAGTAGATTCTACCAGCACAG
GTTTCCAGAGGTGGAGGATGTAGTGATGGTCAATGTCAGG
TCAATTGCAGAAATGGGCGCTTACGTCAGTCTGCTGGAGT
ACAACAACATCGAGGGGATGATTTTGCTCAGCGAGCTGTC
CAGGCGACGAATCCGATCCATCAACAAACTCATCCGGATC
GGACGCAACGAGTGTGTGGTGGTCATTCGGGTGGATAAGG
AGAAAGGCTACATTGATTTATCCAAAAGAAGAGTGTCGCC
AGAAGAGGCCATTAAATGTGAAGACAAGTTCACAAAGTCT
AAAACTGTTTACAGCATTTTAAGGCATGTTGCTGAAGTCC
TGGAGTACACCAAAGATGAGCAGCTGGAGAGTCTGTATCA
GAGAACCGCTTGGGTGTTTGATGAGAAGTACAAGCGGCCT
GGATACGGTGCTTATGACGTCTTTAAGCAGGCTGTGTCGG
ATCCAGCTATATTAGATTGTCTGGAATTGACAGAGGAGGA
ACGAGCAGTCCTGATTGATAACATCAACAGACGCCTCACT
CCACAGGCTGTCAAAATCCGAGCAGACATTGAGGTGGCCT
GCTATGGGTATGAGGGCATCGATGCAGTGAAGGAGGCTTT
GAGAGCAGGACTAACATGTTCAACAGAGTGCATGCCCATC
AAGATCAACTTGATTGCTCCTCCTCGATATGTTATGACCA
CGACCACACTGGAGCGCACAGAGGGCCTTTCTGTGCTCAA
TCAAGCCATGGCCGTCATTAAAGAGAAGATCGAAGAGAAG
AGAGGCGTCTTCAACATTCAGATGGAGCCAAAAGTTGTGA
CGGACACGGATGAGACGGAGCTGGCACGACAGTTGGAGCG
GCTGGAGAGAGAAAATGCTGAGGTGGATGGAGATGATGAT
GCAGAGGAAATGGAGGCCAAGACTGAGGACTAGTCTGAAG
AAAGACGACAAACCAGCAGTGCTATAATCATTCCAGAGAC
TTCAGAGTTATAGTGAAGGGGTTATCACATCATGAAGACT
GAAAAAAAACACTGCTTCTGTGATACTAAGCAGATTGTGA
GTGAGAGATGTGGACTACATTGATGTACTTTTGCTTATCG
GATGAGAATCGTGAGAGGAATTTCTTCCATGAACACTAGT
TTTACTTTAGGAATGTTAGTACAGATAGTATTGTAGTTGA
TTTAAGTGACCTTCGTTTCCAGCTTTATTCAAGATGAGAT
TTGTGGTAAAAAAAAACAAACAAAAAAAAAACAAGCAAAA
CTGAAATCTTTATAGACAGCCAGCCAGTTTACTTATCAAA
AATCTGTTCCACAGAGCTAATAAAAACAAGCAGTTTTCAT
GTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations