Transcript

tgfbi-201

ID
ZDB-TSCRIPT-090929-4637
Name
tgfbi-201
Previous Names
  • tgfbi-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000020017 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000020017|OTTDARG00000016647|ZDB-GENE-030131-73 tgfbi|OTTDARP00000016919 tgfbi-001 LG_ BX323077.15 Danio rerio protein_coding KNOWN, 3037 bp
CCGCTGTGGAGTGCGCGCGCAGGGACGCAAGATGAAGCGC
TTGACTTTGTTTGCTCTGGCTATCACCTTAATCGCGACTG
TTTTCGCCGCAAAATCCCCGTATCAGGCGGTTCTTCAACA
CAGCAGAATAAGAGGAAGAACTCAGGGCCCCAATGTTTGT
GCTATGCAGAAGATCCCAGGGTCGGATAAGAAGTACTTCA
CCAACTGCAAGCAATGGTATCGCCGCAAAATATGTGGCAA
ACCAACGGTGATCAGTTATGAGTGCTGCCCTGGATATGAG
AAGGTGATTGGAGAAAAAGGCTGTCCGGCTGCTCTACCTC
TGGTGAACATCTATAAAACCCTGAGTGTGGTTGAAGCCAC
CACAACTAAGATGTACTCCGAGAGAGCGAAATTGCAGGAG
GAGATCGAAGGACCCGGCAGCTTCACATTCTTTGCTCCCA
GCAATGAGGCTTGGGCTGCACTTCCCACTGAAATTCTGGA
TGCCCTGGTGAGCAACGTCAACATTGAGCTCCTGAACGCG
CTGCACTACCACATGATCAACAAACGCTTGACTTCTGAAG
ATCTTAAGCACGGCTCTTCGTTCTCCTCCATGTATCAAGA
CTTTGATGTTCATATCCACCATTATTCTAACGGAATCGTG
ACGGTGAACTGCGCAAGGCTTGTGAAGACAGATCAGCATG
CCACCAATGGAATTGTGCATGTTGTGGACAGAGTCATCAC
TGCCATTACAAACGATGTCAACTCTATTATTGACACTGAT
GATGACCTGGACACTCTGCGGACTGCAGTTGCCGCCGCTG
GTCTCACTACCTTGTTGGAGAACCAGGGTTCTTATACCAT
CTTTGCACCAACGAATGAAGCCTTTGAGAAGATTCCTCCA
GATACACTGACCAGAATTTTGGGAGACCCTGTTGCTCTTA
AAGATCTGCTGAATTTCCACATTCTGAAGAACTTACACTG
CTCTGAGTCCATCGTGGCTGGAACTCCTCTGGAGACCCTG
CAGGGCACCATGCTGGAAGTCGGCTGTGATGGTGAAGATT
TGACCATCAACGGCAAAGCTGTCGTCACGCAGAAAGATAA
GCTTGGAACCAATGGAGTTGTTCACTACATTAATGAGCTT
CTCATTCCTGACTCGGCCAAAACCCTGCTTGAGCTTGCAG
AGGGATCTGTTGTTACTACAGCTGCAAAGCTTTTTAAAGA
TGCTGGTCTTAATGATCACCTGGTCGGCTCTGAGTCTGTG
ACCTTATTAGCCCCCCTCAACGAGGCTTTTAAAGACAAGA
GCTTTGCTATGACTCCTGACATGAAAAAACTGCTGAGAAA
CCACATTCTCAAGGAGAAGTTTTCCTCCAAGAGCCTTTAT
CATGGGCAGGAGTTGGAGACCCTTGGTGGACTGAAACTTA
GAGTGTTTGTGTTCAGAAATAACCTGTGCATTGAGAACGC
CTGCATTGCCGCCCATGACAAAAACGGCCGCTATGCAAAT
ATGTTCCTCGTTGATAGTATCCTGACGCCCCCCCAGGGAA
CTGTCATGGATGTCCTGAAAGCAGATAATCGTTTCAGCAC
TTTGGTTGGCGCCATTCAAAAAGCTGGCTTGACGGAGCTC
CTGAATAAAAAAGGAACCTACACCTTCTTCGCACCAACCA
ACGCTGCTTTCAGTGCATTGCCGTCCGCTGACCTCAACAA
ACTCATGAGAGACCCTAAAGAGCTGGCTAACATCCTCAAA
TACCACATTGGAGATGAGTTCCTGGTCAGTGGAGCTGTGA
CCTCTCATACCAGACTGAAGCCCCTAGCTGGAGACAAACT
GGAGTTGGGCACTCGTAACTCAACCATATATGTGAACCGT
GTGCCTGTGGTGGAGTCTGATCTGATGGCTACCAATGGAG
TTGTGCACGCTGTTAATGTCATCATCAAGCCACTGCCTCC
TAAAATTGTGAGTGACCAGGCCGAAGGCTCAACAATCAGA
CGCACATCTGCTGTCAGGGCTGGGTCTCAAGTATCCAAAA
ATGATGATCTCTTCCAGAAGGTTCTGAGAAGTCACAGCAG
CAGAACATTGTCTCGTGTCCAGTAAACGCTTTCTACAAAG
TAAAACTGTAGTTCATTTTAACCCTCACCACTTTCAGAGG
ATGGAAACACAGAGTTTGGTGTCTTATTTTAAGAAGAGCT
AATTAGAAGATTAAGAAAATCCAGAGAACAACATACAGAA
ATCTGAAAATGCAAAGCAGTTCAACAATGCATTTTTTTCA
AATGCCGAAGATCCTTGGATGGAAAGCAGTGTTATTTTTC
AAATCTCATAAATTGATTATATCAGGTTGCCATGGCACTT
CATGTGTTATGATTTATTCAGTCTGCATTTTTGAATCTGA
TGTCGGTGTTCGATTTATCTTACTTTGTCAGATTGTCCTC
CCATTTAGAAAAGTAAGTTGCACATTTTGATGACGCATTA
TGCTACCCATCAGGTTTTGCTACCAGTGTTAACTTTAATG
TAGAGTAGTGTGATATGAAGCTGTAATATCGCCCTACCTA
ATCCCAAACCCCAACCTCAGAACCATTCAAAAACAATGTT
GGGAGCATAATCTGATGGGTAGGAGGAAATGTCAGGAGAC
CAGTTCATTAATAACATTTTTGTATTTCTCTCTTTATCAT
TTTTGTAATGTTTTTGGTTGTATTTGTTATACCTGTAGCA
TGTTTGCATGGTTTAAGCTGGAACAAATGCTATTTTGTGC
ACATAAAAAACGACCAAAATGATGTCTTCATGTGTAATGT
AAGACCTGTAACTTGTGCAGATTATTCATGTTTATATGCC
AAAGATATTTTGTGAAGAACCAAAGATCACTGTCTGCATA
TTTCATTATAACATGACTGTTTTGTAGCCACAGAGTTATA
GTTTACATATAACTAGTAAGTGCCCTTGAATGTAGTTTGC
GCTGTCTGTTACAAGCCAATTTGTCAGTTCACTGAGCTGA
ATTCACAATGTGGTGGATTGTCATAATGTGTTGATTAATG
TGTGTGGCAATAAAACTCTCACTCAGTTGATTGCTCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations