header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-4628
Transcript Name: tbpl1-201
Previous Name: tbpl1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000019989 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000019989|OTTDARG00000016621|ZDB-GENE-040520-2 tbpl1|OTTDARP00000016891 tbpl1-001 LG_none CR318665.6,BX927365.7 Danio rerio protein_coding KNOWN, 1519 bp
GCCGCTATTTTCCTCCCAACCGCATCGAGGCGCTTATGTG
CGTTTGACCGGACAGTTTCTCATCTCGCGCAGGAACCGAG
GCATCCTTGACAACAATCGCCGGTGGTCTGTTGTTGGCGT
CTTAACGCTTTTGTTTACTTTCCTTGATCTTCACAACGTT
CATTTTATTCGGATATGTGTATTTGTTAATCTTAAATCCC
TTATTTTAACAACTCCTTACCACATCACATAATAAAATTA
CCTGGAACGGACTATTTGACGCCTCATATCAGTCAAGTTG
TGTTTGTTACTTGACATGCATCTGTAAAGGGGTTGACAAG
TTAAGCAAAACATCTAGAGCGGCTCCATGGAACCCAGTAA
CGATGTTGCGCTTGATATCATCGTTACTAATGTCGTATCA
GTATTCAGAACCAGGTGCCATCTAAACCTGCGCACCATCG
GCCTGGAAGGGACAAATGTCATCTACAAGCCTGAAGTGGG
AAAAGTTCTGATGAAGCTGCGGAAACCACGTATCACTGCC
TCTATATGGTCATCAGGGAAAATTATTTGCACTGGAGCAA
CAAGTGAGGAAGAAGCCAAACTAGGTGCTCGACGGTTGGC
CCGCTGTCTACAGAAGATGGGATTTAAGGTGAGGTTCTCG
GATTTTAAGGTTGTCAATGTGCTGGCAGTGTGCTCCATGC
CTTTTCAGATCCGTCTCATTGAGTTCACTAAGAACAACCG
GCCCATTGCCAGCTACGAGCCCGAGCTTCATCCTGCTGCG
TCATACAGAATCAAAAACCTCAGGAGTACAGTGCAGGTGT
TTTCCACAGGCAATATCACTGTTACAGGACCAAATGTACA
GAGTGTGGCGTCTGCCGTGGAGGAGATTTATCCTCTGCTG
TTTGAGTGTCGGAAAACACTGTCATAAACCACACGCACAC
ACGTAGGCACCGGTTTGAAATGAAAAGCACCTTATCATTG
AATGTTTTAAGGCTTGTAACTGTTGTACTGTATGTGTCTC
CAAGGCAGCTTTTTTGCCATTTCACGTCCAAGCGGGTCTG
GGTCGTGTGTTTTCAGAGTCATGCCTTTGAACGTTGACTT
TGGTGTTTTCGGACCCCACGACGATTAATGACGACCTCTT
AAAGCTCAGAAGAGGACCATTAGTGCATTGACATTGTGTT
GCTGACATTGTGTAGTTTATAAACACTTGAATTAACTGTA
TTATAATGCATGGACACCAAAGTAAAAACTGGCAAGCAGT
GACATTTTAAGAATCGCATTTTAATGAAACGTCTTGGAAG
TTTTAGGTATGTTAATTCTAGTGACGTCTTTACGGCTCAT
TTAACGATACTATAAATCAGAAGCGAGAGGTTAAAGGGCA
AACAAACACTTCACATTTCAACAGCAGGTGATGCATTTCT
GGTTTACGCTGTGGACTGGAACACTCTGGATTGTGGAGGA
GTCTTTGGTCCATATGTTTATGTAATATGTGAAAACTTTT
GTATTTTATAATAAACAAATAAAATAACCTCTATATTAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
tbpl1-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000019989 (1),  Ensembl_Trans:ENSDART00000053534 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC085661 (1) 1505 bp
GenBank:AF503448 (1) 1447 bp
GenBank:CK698612 (1) 844 bp
GenBank:CK684022 (1) 831 bp
GenBank:CF996418 (1) 794 bp
GenBank:DN597988 (1) 774 bp
GenBank:CK689381 (1) 773 bp
GenBank:CK026030 (1) 750 bp
GenBank:CV481224 (1) 734 bp
GenBank:DT066105 (1) 733 bp
GenBank:CO356368 (1) 640 bp
GenBank:BM571582 (1) 577 bp
GenBank:BQ133122 (1) 520 bp
GenBank:BM570963 (1) 519 bp
GenBank:BQ092148 (1) 512 bp
GenBank:BQ481137 (1) 495 bp
GenBank:CK709283 (1) 472 bp
GenBank:BG883974 (1) 429 bp
GenBank:CK400505 (1) 392 bp
GenBank:CK693245 (1) 313 bp
CITATIONS (2)